ID: 1130582616

View in Genome Browser
Species Human (GRCh38)
Location 15:85152166-85152188
Sequence TCCAGCTCTTCTCCCAGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130582616_1130582620 25 Left 1130582616 15:85152166-85152188 CCAGGACTGGGAGAAGAGCTGGA No data
Right 1130582620 15:85152214-85152236 TTATTTAATCAATCACGCCTAGG No data
1130582616_1130582621 30 Left 1130582616 15:85152166-85152188 CCAGGACTGGGAGAAGAGCTGGA No data
Right 1130582621 15:85152219-85152241 TAATCAATCACGCCTAGGTAAGG No data
1130582616_1130582617 -2 Left 1130582616 15:85152166-85152188 CCAGGACTGGGAGAAGAGCTGGA No data
Right 1130582617 15:85152187-85152209 GAGTTTGAGTTAATTACCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130582616 Original CRISPR TCCAGCTCTTCTCCCAGTCC TGG (reversed) Intergenic