ID: 1130582617

View in Genome Browser
Species Human (GRCh38)
Location 15:85152187-85152209
Sequence GAGTTTGAGTTAATTACCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130582616_1130582617 -2 Left 1130582616 15:85152166-85152188 CCAGGACTGGGAGAAGAGCTGGA No data
Right 1130582617 15:85152187-85152209 GAGTTTGAGTTAATTACCAGTGG No data
1130582608_1130582617 12 Left 1130582608 15:85152152-85152174 CCTACCCCTGACCTCCAGGACTG No data
Right 1130582617 15:85152187-85152209 GAGTTTGAGTTAATTACCAGTGG No data
1130582613_1130582617 6 Left 1130582613 15:85152158-85152180 CCTGACCTCCAGGACTGGGAGAA No data
Right 1130582617 15:85152187-85152209 GAGTTTGAGTTAATTACCAGTGG No data
1130582612_1130582617 7 Left 1130582612 15:85152157-85152179 CCCTGACCTCCAGGACTGGGAGA No data
Right 1130582617 15:85152187-85152209 GAGTTTGAGTTAATTACCAGTGG No data
1130582614_1130582617 1 Left 1130582614 15:85152163-85152185 CCTCCAGGACTGGGAGAAGAGCT No data
Right 1130582617 15:85152187-85152209 GAGTTTGAGTTAATTACCAGTGG No data
1130582611_1130582617 8 Left 1130582611 15:85152156-85152178 CCCCTGACCTCCAGGACTGGGAG No data
Right 1130582617 15:85152187-85152209 GAGTTTGAGTTAATTACCAGTGG No data
1130582607_1130582617 13 Left 1130582607 15:85152151-85152173 CCCTACCCCTGACCTCCAGGACT No data
Right 1130582617 15:85152187-85152209 GAGTTTGAGTTAATTACCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130582617 Original CRISPR GAGTTTGAGTTAATTACCAG TGG Intergenic