ID: 1130582620

View in Genome Browser
Species Human (GRCh38)
Location 15:85152214-85152236
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130582614_1130582620 28 Left 1130582614 15:85152163-85152185 CCTCCAGGACTGGGAGAAGAGCT No data
Right 1130582620 15:85152214-85152236 TTATTTAATCAATCACGCCTAGG No data
1130582616_1130582620 25 Left 1130582616 15:85152166-85152188 CCAGGACTGGGAGAAGAGCTGGA No data
Right 1130582620 15:85152214-85152236 TTATTTAATCAATCACGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130582620 Original CRISPR TTATTTAATCAATCACGCCT AGG Intergenic