ID: 1130586565

View in Genome Browser
Species Human (GRCh38)
Location 15:85188215-85188237
Sequence GAAAGCCCCTGAAGCTTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130586561_1130586565 1 Left 1130586561 15:85188191-85188213 CCTTTCCAAGAGACACTTTTCCT No data
Right 1130586565 15:85188215-85188237 GAAAGCCCCTGAAGCTTAGCTGG No data
1130586560_1130586565 2 Left 1130586560 15:85188190-85188212 CCCTTTCCAAGAGACACTTTTCC No data
Right 1130586565 15:85188215-85188237 GAAAGCCCCTGAAGCTTAGCTGG No data
1130586563_1130586565 -4 Left 1130586563 15:85188196-85188218 CCAAGAGACACTTTTCCTGGAAA No data
Right 1130586565 15:85188215-85188237 GAAAGCCCCTGAAGCTTAGCTGG No data
1130586559_1130586565 19 Left 1130586559 15:85188173-85188195 CCGATGAAAAGGTCACACCCTTT No data
Right 1130586565 15:85188215-85188237 GAAAGCCCCTGAAGCTTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130586565 Original CRISPR GAAAGCCCCTGAAGCTTAGC TGG Intergenic
No off target data available for this crispr