ID: 1130590809

View in Genome Browser
Species Human (GRCh38)
Location 15:85209352-85209374
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130590809_1130590819 5 Left 1130590809 15:85209352-85209374 CCCCCCTTGTTGGCCCATGCCAG No data
Right 1130590819 15:85209380-85209402 ACTCACCTGCAGCTTCTCCATGG No data
1130590809_1130590821 16 Left 1130590809 15:85209352-85209374 CCCCCCTTGTTGGCCCATGCCAG No data
Right 1130590821 15:85209391-85209413 GCTTCTCCATGGCCCCCTGCAGG No data
1130590809_1130590824 22 Left 1130590809 15:85209352-85209374 CCCCCCTTGTTGGCCCATGCCAG No data
Right 1130590824 15:85209397-85209419 CCATGGCCCCCTGCAGGGCCCGG No data
1130590809_1130590825 25 Left 1130590809 15:85209352-85209374 CCCCCCTTGTTGGCCCATGCCAG No data
Right 1130590825 15:85209400-85209422 TGGCCCCCTGCAGGGCCCGGTGG No data
1130590809_1130590826 26 Left 1130590809 15:85209352-85209374 CCCCCCTTGTTGGCCCATGCCAG No data
Right 1130590826 15:85209401-85209423 GGCCCCCTGCAGGGCCCGGTGGG No data
1130590809_1130590822 17 Left 1130590809 15:85209352-85209374 CCCCCCTTGTTGGCCCATGCCAG No data
Right 1130590822 15:85209392-85209414 CTTCTCCATGGCCCCCTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130590809 Original CRISPR CTGGCATGGGCCAACAAGGG GGG (reversed) Intergenic