ID: 1130590818

View in Genome Browser
Species Human (GRCh38)
Location 15:85209377-85209399
Sequence TGGAGAAGCTGCAGGTGAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130590818_1130590821 -9 Left 1130590818 15:85209377-85209399 CCTACTCACCTGCAGCTTCTCCA No data
Right 1130590821 15:85209391-85209413 GCTTCTCCATGGCCCCCTGCAGG No data
1130590818_1130590826 1 Left 1130590818 15:85209377-85209399 CCTACTCACCTGCAGCTTCTCCA No data
Right 1130590826 15:85209401-85209423 GGCCCCCTGCAGGGCCCGGTGGG No data
1130590818_1130590824 -3 Left 1130590818 15:85209377-85209399 CCTACTCACCTGCAGCTTCTCCA No data
Right 1130590824 15:85209397-85209419 CCATGGCCCCCTGCAGGGCCCGG No data
1130590818_1130590822 -8 Left 1130590818 15:85209377-85209399 CCTACTCACCTGCAGCTTCTCCA No data
Right 1130590822 15:85209392-85209414 CTTCTCCATGGCCCCCTGCAGGG No data
1130590818_1130590825 0 Left 1130590818 15:85209377-85209399 CCTACTCACCTGCAGCTTCTCCA No data
Right 1130590825 15:85209400-85209422 TGGCCCCCTGCAGGGCCCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130590818 Original CRISPR TGGAGAAGCTGCAGGTGAGT AGG (reversed) Intergenic