ID: 1130590820

View in Genome Browser
Species Human (GRCh38)
Location 15:85209385-85209407
Sequence GGGGGCCATGGAGAAGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130590820_1130590836 27 Left 1130590820 15:85209385-85209407 CCTGCAGCTTCTCCATGGCCCCC No data
Right 1130590836 15:85209435-85209457 ACAGACTCACCCCCACTCTCTGG No data
1130590820_1130590826 -7 Left 1130590820 15:85209385-85209407 CCTGCAGCTTCTCCATGGCCCCC No data
Right 1130590826 15:85209401-85209423 GGCCCCCTGCAGGGCCCGGTGGG No data
1130590820_1130590825 -8 Left 1130590820 15:85209385-85209407 CCTGCAGCTTCTCCATGGCCCCC No data
Right 1130590825 15:85209400-85209422 TGGCCCCCTGCAGGGCCCGGTGG No data
1130590820_1130590837 28 Left 1130590820 15:85209385-85209407 CCTGCAGCTTCTCCATGGCCCCC No data
Right 1130590837 15:85209436-85209458 CAGACTCACCCCCACTCTCTGGG No data
1130590820_1130590838 29 Left 1130590820 15:85209385-85209407 CCTGCAGCTTCTCCATGGCCCCC No data
Right 1130590838 15:85209437-85209459 AGACTCACCCCCACTCTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130590820 Original CRISPR GGGGGCCATGGAGAAGCTGC AGG (reversed) Intergenic