ID: 1130590826

View in Genome Browser
Species Human (GRCh38)
Location 15:85209401-85209423
Sequence GGCCCCCTGCAGGGCCCGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130590818_1130590826 1 Left 1130590818 15:85209377-85209399 CCTACTCACCTGCAGCTTCTCCA No data
Right 1130590826 15:85209401-85209423 GGCCCCCTGCAGGGCCCGGTGGG No data
1130590808_1130590826 29 Left 1130590808 15:85209349-85209371 CCGCCCCCCTTGTTGGCCCATGC No data
Right 1130590826 15:85209401-85209423 GGCCCCCTGCAGGGCCCGGTGGG No data
1130590817_1130590826 7 Left 1130590817 15:85209371-85209393 CCAGGACCTACTCACCTGCAGCT No data
Right 1130590826 15:85209401-85209423 GGCCCCCTGCAGGGCCCGGTGGG No data
1130590813_1130590826 23 Left 1130590813 15:85209355-85209377 CCCTTGTTGGCCCATGCCAGGAC No data
Right 1130590826 15:85209401-85209423 GGCCCCCTGCAGGGCCCGGTGGG No data
1130590812_1130590826 24 Left 1130590812 15:85209354-85209376 CCCCTTGTTGGCCCATGCCAGGA No data
Right 1130590826 15:85209401-85209423 GGCCCCCTGCAGGGCCCGGTGGG No data
1130590820_1130590826 -7 Left 1130590820 15:85209385-85209407 CCTGCAGCTTCTCCATGGCCCCC No data
Right 1130590826 15:85209401-85209423 GGCCCCCTGCAGGGCCCGGTGGG No data
1130590809_1130590826 26 Left 1130590809 15:85209352-85209374 CCCCCCTTGTTGGCCCATGCCAG No data
Right 1130590826 15:85209401-85209423 GGCCCCCTGCAGGGCCCGGTGGG No data
1130590816_1130590826 12 Left 1130590816 15:85209366-85209388 CCATGCCAGGACCTACTCACCTG No data
Right 1130590826 15:85209401-85209423 GGCCCCCTGCAGGGCCCGGTGGG No data
1130590810_1130590826 25 Left 1130590810 15:85209353-85209375 CCCCCTTGTTGGCCCATGCCAGG No data
Right 1130590826 15:85209401-85209423 GGCCCCCTGCAGGGCCCGGTGGG No data
1130590814_1130590826 22 Left 1130590814 15:85209356-85209378 CCTTGTTGGCCCATGCCAGGACC No data
Right 1130590826 15:85209401-85209423 GGCCCCCTGCAGGGCCCGGTGGG No data
1130590815_1130590826 13 Left 1130590815 15:85209365-85209387 CCCATGCCAGGACCTACTCACCT No data
Right 1130590826 15:85209401-85209423 GGCCCCCTGCAGGGCCCGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130590826 Original CRISPR GGCCCCCTGCAGGGCCCGGT GGG Intergenic