ID: 1130594587

View in Genome Browser
Species Human (GRCh38)
Location 15:85240738-85240760
Sequence CTGCCCTTGCCAATCACCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130594573_1130594587 30 Left 1130594573 15:85240685-85240707 CCCAACCAAAGCCTAGTCAGTCA No data
Right 1130594587 15:85240738-85240760 CTGCCCTTGCCAATCACCCCAGG No data
1130594576_1130594587 19 Left 1130594576 15:85240696-85240718 CCTAGTCAGTCAGCCCCACCCCT No data
Right 1130594587 15:85240738-85240760 CTGCCCTTGCCAATCACCCCAGG No data
1130594578_1130594587 5 Left 1130594578 15:85240710-85240732 CCCACCCCTTCAGCAAGCAGCCC No data
Right 1130594587 15:85240738-85240760 CTGCCCTTGCCAATCACCCCAGG No data
1130594580_1130594587 1 Left 1130594580 15:85240714-85240736 CCCCTTCAGCAAGCAGCCCAGTC No data
Right 1130594587 15:85240738-85240760 CTGCCCTTGCCAATCACCCCAGG No data
1130594581_1130594587 0 Left 1130594581 15:85240715-85240737 CCCTTCAGCAAGCAGCCCAGTCC No data
Right 1130594587 15:85240738-85240760 CTGCCCTTGCCAATCACCCCAGG No data
1130594582_1130594587 -1 Left 1130594582 15:85240716-85240738 CCTTCAGCAAGCAGCCCAGTCCC No data
Right 1130594587 15:85240738-85240760 CTGCCCTTGCCAATCACCCCAGG No data
1130594574_1130594587 29 Left 1130594574 15:85240686-85240708 CCAACCAAAGCCTAGTCAGTCAG No data
Right 1130594587 15:85240738-85240760 CTGCCCTTGCCAATCACCCCAGG No data
1130594575_1130594587 25 Left 1130594575 15:85240690-85240712 CCAAAGCCTAGTCAGTCAGCCCC No data
Right 1130594587 15:85240738-85240760 CTGCCCTTGCCAATCACCCCAGG No data
1130594577_1130594587 6 Left 1130594577 15:85240709-85240731 CCCCACCCCTTCAGCAAGCAGCC No data
Right 1130594587 15:85240738-85240760 CTGCCCTTGCCAATCACCCCAGG No data
1130594579_1130594587 4 Left 1130594579 15:85240711-85240733 CCACCCCTTCAGCAAGCAGCCCA No data
Right 1130594587 15:85240738-85240760 CTGCCCTTGCCAATCACCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130594587 Original CRISPR CTGCCCTTGCCAATCACCCC AGG Intergenic
No off target data available for this crispr