ID: 1130596794

View in Genome Browser
Species Human (GRCh38)
Location 15:85254680-85254702
Sequence CTGTGGGTAGGCAGGTGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130596783_1130596794 10 Left 1130596783 15:85254647-85254669 CCATGGGACTAGATTTTATGGGA No data
Right 1130596794 15:85254680-85254702 CTGTGGGTAGGCAGGTGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130596794 Original CRISPR CTGTGGGTAGGCAGGTGCCA AGG Intergenic
No off target data available for this crispr