ID: 1130597893

View in Genome Browser
Species Human (GRCh38)
Location 15:85259322-85259344
Sequence ACTGGCTGCTGAGTGACTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 673
Summary {0: 3, 1: 0, 2: 4, 3: 60, 4: 606}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130597893_1130597901 25 Left 1130597893 15:85259322-85259344 CCCAGAGTCACTCAGCAGCCAGT 0: 3
1: 0
2: 4
3: 60
4: 606
Right 1130597901 15:85259370-85259392 CTGACTCCCGGACCCAGCTCAGG 0: 2
1: 2
2: 2
3: 16
4: 204
1130597893_1130597898 13 Left 1130597893 15:85259322-85259344 CCCAGAGTCACTCAGCAGCCAGT 0: 3
1: 0
2: 4
3: 60
4: 606
Right 1130597898 15:85259358-85259380 ACGCTGGCCCAGCTGACTCCCGG 0: 4
1: 0
2: 3
3: 16
4: 181
1130597893_1130597897 -3 Left 1130597893 15:85259322-85259344 CCCAGAGTCACTCAGCAGCCAGT 0: 3
1: 0
2: 4
3: 60
4: 606
Right 1130597897 15:85259342-85259364 AGTCGGACAGACTCAAACGCTGG 0: 2
1: 0
2: 0
3: 6
4: 52
1130597893_1130597902 26 Left 1130597893 15:85259322-85259344 CCCAGAGTCACTCAGCAGCCAGT 0: 3
1: 0
2: 4
3: 60
4: 606
Right 1130597902 15:85259371-85259393 TGACTCCCGGACCCAGCTCAGGG 0: 2
1: 2
2: 0
3: 10
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130597893 Original CRISPR ACTGGCTGCTGAGTGACTCT GGG (reversed) Intergenic