ID: 1130600218

View in Genome Browser
Species Human (GRCh38)
Location 15:85269288-85269310
Sequence TGTGACTTTGAGATTGACTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130600218_1130600228 23 Left 1130600218 15:85269288-85269310 CCAGAGTCAATCTCAAAGTCACA No data
Right 1130600228 15:85269334-85269356 GGAGGGGAGGCCCCTGGTGCTGG No data
1130600218_1130600224 6 Left 1130600218 15:85269288-85269310 CCAGAGTCAATCTCAAAGTCACA No data
Right 1130600224 15:85269317-85269339 CGTTCTGCAACACACGAGGAGGG No data
1130600218_1130600221 2 Left 1130600218 15:85269288-85269310 CCAGAGTCAATCTCAAAGTCACA No data
Right 1130600221 15:85269313-85269335 CCCACGTTCTGCAACACACGAGG No data
1130600218_1130600229 26 Left 1130600218 15:85269288-85269310 CCAGAGTCAATCTCAAAGTCACA No data
Right 1130600229 15:85269337-85269359 GGGGAGGCCCCTGGTGCTGGCGG No data
1130600218_1130600223 5 Left 1130600218 15:85269288-85269310 CCAGAGTCAATCTCAAAGTCACA No data
Right 1130600223 15:85269316-85269338 ACGTTCTGCAACACACGAGGAGG No data
1130600218_1130600226 10 Left 1130600218 15:85269288-85269310 CCAGAGTCAATCTCAAAGTCACA No data
Right 1130600226 15:85269321-85269343 CTGCAACACACGAGGAGGGGAGG No data
1130600218_1130600227 17 Left 1130600218 15:85269288-85269310 CCAGAGTCAATCTCAAAGTCACA No data
Right 1130600227 15:85269328-85269350 ACACGAGGAGGGGAGGCCCCTGG No data
1130600218_1130600225 7 Left 1130600218 15:85269288-85269310 CCAGAGTCAATCTCAAAGTCACA No data
Right 1130600225 15:85269318-85269340 GTTCTGCAACACACGAGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130600218 Original CRISPR TGTGACTTTGAGATTGACTC TGG (reversed) Intergenic