ID: 1130600219

View in Genome Browser
Species Human (GRCh38)
Location 15:85269312-85269334
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130600219_1130600228 -1 Left 1130600219 15:85269312-85269334 CCCCACGTTCTGCAACACACGAG No data
Right 1130600228 15:85269334-85269356 GGAGGGGAGGCCCCTGGTGCTGG No data
1130600219_1130600235 28 Left 1130600219 15:85269312-85269334 CCCCACGTTCTGCAACACACGAG No data
Right 1130600235 15:85269363-85269385 GCCCTCTGTGGCCCCAGCCCCGG No data
1130600219_1130600229 2 Left 1130600219 15:85269312-85269334 CCCCACGTTCTGCAACACACGAG No data
Right 1130600229 15:85269337-85269359 GGGGAGGCCCCTGGTGCTGGCGG No data
1130600219_1130600239 30 Left 1130600219 15:85269312-85269334 CCCCACGTTCTGCAACACACGAG No data
Right 1130600239 15:85269365-85269387 CCTCTGTGGCCCCAGCCCCGGGG No data
1130600219_1130600233 16 Left 1130600219 15:85269312-85269334 CCCCACGTTCTGCAACACACGAG No data
Right 1130600233 15:85269351-85269373 TGCTGGCGGCCAGCCCTCTGTGG No data
1130600219_1130600227 -7 Left 1130600219 15:85269312-85269334 CCCCACGTTCTGCAACACACGAG No data
Right 1130600227 15:85269328-85269350 ACACGAGGAGGGGAGGCCCCTGG No data
1130600219_1130600237 29 Left 1130600219 15:85269312-85269334 CCCCACGTTCTGCAACACACGAG No data
Right 1130600237 15:85269364-85269386 CCCTCTGTGGCCCCAGCCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130600219 Original CRISPR CTCGTGTGTTGCAGAACGTG GGG (reversed) Intergenic