ID: 1130600220

View in Genome Browser
Species Human (GRCh38)
Location 15:85269313-85269335
Sequence CCTCGTGTGTTGCAGAACGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130600220_1130600233 15 Left 1130600220 15:85269313-85269335 CCCACGTTCTGCAACACACGAGG No data
Right 1130600233 15:85269351-85269373 TGCTGGCGGCCAGCCCTCTGTGG No data
1130600220_1130600227 -8 Left 1130600220 15:85269313-85269335 CCCACGTTCTGCAACACACGAGG No data
Right 1130600227 15:85269328-85269350 ACACGAGGAGGGGAGGCCCCTGG No data
1130600220_1130600229 1 Left 1130600220 15:85269313-85269335 CCCACGTTCTGCAACACACGAGG No data
Right 1130600229 15:85269337-85269359 GGGGAGGCCCCTGGTGCTGGCGG No data
1130600220_1130600228 -2 Left 1130600220 15:85269313-85269335 CCCACGTTCTGCAACACACGAGG No data
Right 1130600228 15:85269334-85269356 GGAGGGGAGGCCCCTGGTGCTGG No data
1130600220_1130600235 27 Left 1130600220 15:85269313-85269335 CCCACGTTCTGCAACACACGAGG No data
Right 1130600235 15:85269363-85269385 GCCCTCTGTGGCCCCAGCCCCGG No data
1130600220_1130600239 29 Left 1130600220 15:85269313-85269335 CCCACGTTCTGCAACACACGAGG No data
Right 1130600239 15:85269365-85269387 CCTCTGTGGCCCCAGCCCCGGGG No data
1130600220_1130600240 30 Left 1130600220 15:85269313-85269335 CCCACGTTCTGCAACACACGAGG No data
Right 1130600240 15:85269366-85269388 CTCTGTGGCCCCAGCCCCGGGGG No data
1130600220_1130600237 28 Left 1130600220 15:85269313-85269335 CCCACGTTCTGCAACACACGAGG No data
Right 1130600237 15:85269364-85269386 CCCTCTGTGGCCCCAGCCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130600220 Original CRISPR CCTCGTGTGTTGCAGAACGT GGG (reversed) Intergenic