ID: 1130600222

View in Genome Browser
Species Human (GRCh38)
Location 15:85269314-85269336
Sequence TCCTCGTGTGTTGCAGAACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130600222_1130600240 29 Left 1130600222 15:85269314-85269336 CCACGTTCTGCAACACACGAGGA No data
Right 1130600240 15:85269366-85269388 CTCTGTGGCCCCAGCCCCGGGGG No data
1130600222_1130600228 -3 Left 1130600222 15:85269314-85269336 CCACGTTCTGCAACACACGAGGA No data
Right 1130600228 15:85269334-85269356 GGAGGGGAGGCCCCTGGTGCTGG No data
1130600222_1130600235 26 Left 1130600222 15:85269314-85269336 CCACGTTCTGCAACACACGAGGA No data
Right 1130600235 15:85269363-85269385 GCCCTCTGTGGCCCCAGCCCCGG No data
1130600222_1130600227 -9 Left 1130600222 15:85269314-85269336 CCACGTTCTGCAACACACGAGGA No data
Right 1130600227 15:85269328-85269350 ACACGAGGAGGGGAGGCCCCTGG No data
1130600222_1130600233 14 Left 1130600222 15:85269314-85269336 CCACGTTCTGCAACACACGAGGA No data
Right 1130600233 15:85269351-85269373 TGCTGGCGGCCAGCCCTCTGTGG No data
1130600222_1130600237 27 Left 1130600222 15:85269314-85269336 CCACGTTCTGCAACACACGAGGA No data
Right 1130600237 15:85269364-85269386 CCCTCTGTGGCCCCAGCCCCGGG No data
1130600222_1130600229 0 Left 1130600222 15:85269314-85269336 CCACGTTCTGCAACACACGAGGA No data
Right 1130600229 15:85269337-85269359 GGGGAGGCCCCTGGTGCTGGCGG No data
1130600222_1130600239 28 Left 1130600222 15:85269314-85269336 CCACGTTCTGCAACACACGAGGA No data
Right 1130600239 15:85269365-85269387 CCTCTGTGGCCCCAGCCCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130600222 Original CRISPR TCCTCGTGTGTTGCAGAACG TGG (reversed) Intergenic
No off target data available for this crispr