ID: 1130600223

View in Genome Browser
Species Human (GRCh38)
Location 15:85269316-85269338
Sequence ACGTTCTGCAACACACGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130600217_1130600223 13 Left 1130600217 15:85269280-85269302 CCATAGTGCCAGAGTCAATCTCA No data
Right 1130600223 15:85269316-85269338 ACGTTCTGCAACACACGAGGAGG No data
1130600216_1130600223 16 Left 1130600216 15:85269277-85269299 CCTCCATAGTGCCAGAGTCAATC No data
Right 1130600223 15:85269316-85269338 ACGTTCTGCAACACACGAGGAGG No data
1130600215_1130600223 26 Left 1130600215 15:85269267-85269289 CCACAGCGGTCCTCCATAGTGCC No data
Right 1130600223 15:85269316-85269338 ACGTTCTGCAACACACGAGGAGG No data
1130600218_1130600223 5 Left 1130600218 15:85269288-85269310 CCAGAGTCAATCTCAAAGTCACA No data
Right 1130600223 15:85269316-85269338 ACGTTCTGCAACACACGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130600223 Original CRISPR ACGTTCTGCAACACACGAGG AGG Intergenic