ID: 1130600224

View in Genome Browser
Species Human (GRCh38)
Location 15:85269317-85269339
Sequence CGTTCTGCAACACACGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130600215_1130600224 27 Left 1130600215 15:85269267-85269289 CCACAGCGGTCCTCCATAGTGCC No data
Right 1130600224 15:85269317-85269339 CGTTCTGCAACACACGAGGAGGG No data
1130600217_1130600224 14 Left 1130600217 15:85269280-85269302 CCATAGTGCCAGAGTCAATCTCA No data
Right 1130600224 15:85269317-85269339 CGTTCTGCAACACACGAGGAGGG No data
1130600216_1130600224 17 Left 1130600216 15:85269277-85269299 CCTCCATAGTGCCAGAGTCAATC No data
Right 1130600224 15:85269317-85269339 CGTTCTGCAACACACGAGGAGGG No data
1130600218_1130600224 6 Left 1130600218 15:85269288-85269310 CCAGAGTCAATCTCAAAGTCACA No data
Right 1130600224 15:85269317-85269339 CGTTCTGCAACACACGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130600224 Original CRISPR CGTTCTGCAACACACGAGGA GGG Intergenic