ID: 1130600227

View in Genome Browser
Species Human (GRCh38)
Location 15:85269328-85269350
Sequence ACACGAGGAGGGGAGGCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130600220_1130600227 -8 Left 1130600220 15:85269313-85269335 CCCACGTTCTGCAACACACGAGG No data
Right 1130600227 15:85269328-85269350 ACACGAGGAGGGGAGGCCCCTGG No data
1130600216_1130600227 28 Left 1130600216 15:85269277-85269299 CCTCCATAGTGCCAGAGTCAATC No data
Right 1130600227 15:85269328-85269350 ACACGAGGAGGGGAGGCCCCTGG No data
1130600218_1130600227 17 Left 1130600218 15:85269288-85269310 CCAGAGTCAATCTCAAAGTCACA No data
Right 1130600227 15:85269328-85269350 ACACGAGGAGGGGAGGCCCCTGG No data
1130600222_1130600227 -9 Left 1130600222 15:85269314-85269336 CCACGTTCTGCAACACACGAGGA No data
Right 1130600227 15:85269328-85269350 ACACGAGGAGGGGAGGCCCCTGG No data
1130600217_1130600227 25 Left 1130600217 15:85269280-85269302 CCATAGTGCCAGAGTCAATCTCA No data
Right 1130600227 15:85269328-85269350 ACACGAGGAGGGGAGGCCCCTGG No data
1130600219_1130600227 -7 Left 1130600219 15:85269312-85269334 CCCCACGTTCTGCAACACACGAG 0: 2
1: 0
2: 0
3: 11
4: 60
Right 1130600227 15:85269328-85269350 ACACGAGGAGGGGAGGCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130600227 Original CRISPR ACACGAGGAGGGGAGGCCCC TGG Intergenic