ID: 1130600232

View in Genome Browser
Species Human (GRCh38)
Location 15:85269346-85269368
Sequence GAGGGCTGGCCGCCAGCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130600232_1130600239 -4 Left 1130600232 15:85269346-85269368 CCTGGTGCTGGCGGCCAGCCCTC No data
Right 1130600239 15:85269365-85269387 CCTCTGTGGCCCCAGCCCCGGGG No data
1130600232_1130600235 -6 Left 1130600232 15:85269346-85269368 CCTGGTGCTGGCGGCCAGCCCTC No data
Right 1130600235 15:85269363-85269385 GCCCTCTGTGGCCCCAGCCCCGG No data
1130600232_1130600245 7 Left 1130600232 15:85269346-85269368 CCTGGTGCTGGCGGCCAGCCCTC No data
Right 1130600245 15:85269376-85269398 CCAGCCCCGGGGGCCAGCCAGGG No data
1130600232_1130600237 -5 Left 1130600232 15:85269346-85269368 CCTGGTGCTGGCGGCCAGCCCTC No data
Right 1130600237 15:85269364-85269386 CCCTCTGTGGCCCCAGCCCCGGG No data
1130600232_1130600248 12 Left 1130600232 15:85269346-85269368 CCTGGTGCTGGCGGCCAGCCCTC No data
Right 1130600248 15:85269381-85269403 CCCGGGGGCCAGCCAGGGTCAGG No data
1130600232_1130600253 26 Left 1130600232 15:85269346-85269368 CCTGGTGCTGGCGGCCAGCCCTC No data
Right 1130600253 15:85269395-85269417 AGGGTCAGGAGAAGAAAGCTGGG No data
1130600232_1130600243 6 Left 1130600232 15:85269346-85269368 CCTGGTGCTGGCGGCCAGCCCTC No data
Right 1130600243 15:85269375-85269397 CCCAGCCCCGGGGGCCAGCCAGG No data
1130600232_1130600252 25 Left 1130600232 15:85269346-85269368 CCTGGTGCTGGCGGCCAGCCCTC No data
Right 1130600252 15:85269394-85269416 CAGGGTCAGGAGAAGAAAGCTGG No data
1130600232_1130600240 -3 Left 1130600232 15:85269346-85269368 CCTGGTGCTGGCGGCCAGCCCTC No data
Right 1130600240 15:85269366-85269388 CTCTGTGGCCCCAGCCCCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130600232 Original CRISPR GAGGGCTGGCCGCCAGCACC AGG (reversed) Intergenic