ID: 1130600233

View in Genome Browser
Species Human (GRCh38)
Location 15:85269351-85269373
Sequence TGCTGGCGGCCAGCCCTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130600220_1130600233 15 Left 1130600220 15:85269313-85269335 CCCACGTTCTGCAACACACGAGG No data
Right 1130600233 15:85269351-85269373 TGCTGGCGGCCAGCCCTCTGTGG No data
1130600219_1130600233 16 Left 1130600219 15:85269312-85269334 CCCCACGTTCTGCAACACACGAG 0: 2
1: 0
2: 0
3: 11
4: 60
Right 1130600233 15:85269351-85269373 TGCTGGCGGCCAGCCCTCTGTGG No data
1130600222_1130600233 14 Left 1130600222 15:85269314-85269336 CCACGTTCTGCAACACACGAGGA No data
Right 1130600233 15:85269351-85269373 TGCTGGCGGCCAGCCCTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130600233 Original CRISPR TGCTGGCGGCCAGCCCTCTG TGG Intergenic