ID: 1130600234

View in Genome Browser
Species Human (GRCh38)
Location 15:85269360-85269382
Sequence GGGCTGGGGCCACAGAGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130600234_1130600260 28 Left 1130600234 15:85269360-85269382 CCAGCCCTCTGTGGCCCCAGCCC No data
Right 1130600260 15:85269411-85269433 AGCTGGGAGTGGGGGTCGGGAGG No data
1130600234_1130600257 20 Left 1130600234 15:85269360-85269382 CCAGCCCTCTGTGGCCCCAGCCC No data
Right 1130600257 15:85269403-85269425 GAGAAGAAAGCTGGGAGTGGGGG No data
1130600234_1130600252 11 Left 1130600234 15:85269360-85269382 CCAGCCCTCTGTGGCCCCAGCCC No data
Right 1130600252 15:85269394-85269416 CAGGGTCAGGAGAAGAAAGCTGG No data
1130600234_1130600248 -2 Left 1130600234 15:85269360-85269382 CCAGCCCTCTGTGGCCCCAGCCC No data
Right 1130600248 15:85269381-85269403 CCCGGGGGCCAGCCAGGGTCAGG No data
1130600234_1130600243 -8 Left 1130600234 15:85269360-85269382 CCAGCCCTCTGTGGCCCCAGCCC No data
Right 1130600243 15:85269375-85269397 CCCAGCCCCGGGGGCCAGCCAGG No data
1130600234_1130600256 19 Left 1130600234 15:85269360-85269382 CCAGCCCTCTGTGGCCCCAGCCC No data
Right 1130600256 15:85269402-85269424 GGAGAAGAAAGCTGGGAGTGGGG No data
1130600234_1130600254 17 Left 1130600234 15:85269360-85269382 CCAGCCCTCTGTGGCCCCAGCCC No data
Right 1130600254 15:85269400-85269422 CAGGAGAAGAAAGCTGGGAGTGG No data
1130600234_1130600259 25 Left 1130600234 15:85269360-85269382 CCAGCCCTCTGTGGCCCCAGCCC No data
Right 1130600259 15:85269408-85269430 GAAAGCTGGGAGTGGGGGTCGGG No data
1130600234_1130600253 12 Left 1130600234 15:85269360-85269382 CCAGCCCTCTGTGGCCCCAGCCC No data
Right 1130600253 15:85269395-85269417 AGGGTCAGGAGAAGAAAGCTGGG No data
1130600234_1130600258 24 Left 1130600234 15:85269360-85269382 CCAGCCCTCTGTGGCCCCAGCCC No data
Right 1130600258 15:85269407-85269429 AGAAAGCTGGGAGTGGGGGTCGG No data
1130600234_1130600245 -7 Left 1130600234 15:85269360-85269382 CCAGCCCTCTGTGGCCCCAGCCC No data
Right 1130600245 15:85269376-85269398 CCAGCCCCGGGGGCCAGCCAGGG No data
1130600234_1130600255 18 Left 1130600234 15:85269360-85269382 CCAGCCCTCTGTGGCCCCAGCCC No data
Right 1130600255 15:85269401-85269423 AGGAGAAGAAAGCTGGGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130600234 Original CRISPR GGGCTGGGGCCACAGAGGGC TGG (reversed) Intergenic