ID: 1130600235

View in Genome Browser
Species Human (GRCh38)
Location 15:85269363-85269385
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130600219_1130600235 28 Left 1130600219 15:85269312-85269334 CCCCACGTTCTGCAACACACGAG 0: 2
1: 0
2: 0
3: 11
4: 60
Right 1130600235 15:85269363-85269385 GCCCTCTGTGGCCCCAGCCCCGG No data
1130600230_1130600235 -4 Left 1130600230 15:85269344-85269366 CCCCTGGTGCTGGCGGCCAGCCC No data
Right 1130600235 15:85269363-85269385 GCCCTCTGTGGCCCCAGCCCCGG No data
1130600220_1130600235 27 Left 1130600220 15:85269313-85269335 CCCACGTTCTGCAACACACGAGG No data
Right 1130600235 15:85269363-85269385 GCCCTCTGTGGCCCCAGCCCCGG No data
1130600222_1130600235 26 Left 1130600222 15:85269314-85269336 CCACGTTCTGCAACACACGAGGA No data
Right 1130600235 15:85269363-85269385 GCCCTCTGTGGCCCCAGCCCCGG No data
1130600231_1130600235 -5 Left 1130600231 15:85269345-85269367 CCCTGGTGCTGGCGGCCAGCCCT No data
Right 1130600235 15:85269363-85269385 GCCCTCTGTGGCCCCAGCCCCGG No data
1130600232_1130600235 -6 Left 1130600232 15:85269346-85269368 CCTGGTGCTGGCGGCCAGCCCTC No data
Right 1130600235 15:85269363-85269385 GCCCTCTGTGGCCCCAGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130600235 Original CRISPR GCCCTCTGTGGCCCCAGCCC CGG Intergenic