ID: 1130600237

View in Genome Browser
Species Human (GRCh38)
Location 15:85269364-85269386
Sequence CCCTCTGTGGCCCCAGCCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130600230_1130600237 -3 Left 1130600230 15:85269344-85269366 CCCCTGGTGCTGGCGGCCAGCCC No data
Right 1130600237 15:85269364-85269386 CCCTCTGTGGCCCCAGCCCCGGG No data
1130600232_1130600237 -5 Left 1130600232 15:85269346-85269368 CCTGGTGCTGGCGGCCAGCCCTC No data
Right 1130600237 15:85269364-85269386 CCCTCTGTGGCCCCAGCCCCGGG No data
1130600219_1130600237 29 Left 1130600219 15:85269312-85269334 CCCCACGTTCTGCAACACACGAG 0: 2
1: 0
2: 0
3: 11
4: 60
Right 1130600237 15:85269364-85269386 CCCTCTGTGGCCCCAGCCCCGGG No data
1130600220_1130600237 28 Left 1130600220 15:85269313-85269335 CCCACGTTCTGCAACACACGAGG No data
Right 1130600237 15:85269364-85269386 CCCTCTGTGGCCCCAGCCCCGGG No data
1130600222_1130600237 27 Left 1130600222 15:85269314-85269336 CCACGTTCTGCAACACACGAGGA No data
Right 1130600237 15:85269364-85269386 CCCTCTGTGGCCCCAGCCCCGGG No data
1130600231_1130600237 -4 Left 1130600231 15:85269345-85269367 CCCTGGTGCTGGCGGCCAGCCCT No data
Right 1130600237 15:85269364-85269386 CCCTCTGTGGCCCCAGCCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130600237 Original CRISPR CCCTCTGTGGCCCCAGCCCC GGG Intergenic