ID: 1130600245

View in Genome Browser
Species Human (GRCh38)
Location 15:85269376-85269398
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130600231_1130600245 8 Left 1130600231 15:85269345-85269367 CCCTGGTGCTGGCGGCCAGCCCT No data
Right 1130600245 15:85269376-85269398 CCAGCCCCGGGGGCCAGCCAGGG No data
1130600230_1130600245 9 Left 1130600230 15:85269344-85269366 CCCCTGGTGCTGGCGGCCAGCCC No data
Right 1130600245 15:85269376-85269398 CCAGCCCCGGGGGCCAGCCAGGG No data
1130600232_1130600245 7 Left 1130600232 15:85269346-85269368 CCTGGTGCTGGCGGCCAGCCCTC No data
Right 1130600245 15:85269376-85269398 CCAGCCCCGGGGGCCAGCCAGGG No data
1130600234_1130600245 -7 Left 1130600234 15:85269360-85269382 CCAGCCCTCTGTGGCCCCAGCCC No data
Right 1130600245 15:85269376-85269398 CCAGCCCCGGGGGCCAGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130600245 Original CRISPR CCAGCCCCGGGGGCCAGCCA GGG Intergenic