ID: 1130600248

View in Genome Browser
Species Human (GRCh38)
Location 15:85269381-85269403
Sequence CCCGGGGGCCAGCCAGGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130600231_1130600248 13 Left 1130600231 15:85269345-85269367 CCCTGGTGCTGGCGGCCAGCCCT No data
Right 1130600248 15:85269381-85269403 CCCGGGGGCCAGCCAGGGTCAGG No data
1130600234_1130600248 -2 Left 1130600234 15:85269360-85269382 CCAGCCCTCTGTGGCCCCAGCCC No data
Right 1130600248 15:85269381-85269403 CCCGGGGGCCAGCCAGGGTCAGG No data
1130600236_1130600248 -6 Left 1130600236 15:85269364-85269386 CCCTCTGTGGCCCCAGCCCCGGG No data
Right 1130600248 15:85269381-85269403 CCCGGGGGCCAGCCAGGGTCAGG No data
1130600238_1130600248 -7 Left 1130600238 15:85269365-85269387 CCTCTGTGGCCCCAGCCCCGGGG No data
Right 1130600248 15:85269381-85269403 CCCGGGGGCCAGCCAGGGTCAGG No data
1130600230_1130600248 14 Left 1130600230 15:85269344-85269366 CCCCTGGTGCTGGCGGCCAGCCC No data
Right 1130600248 15:85269381-85269403 CCCGGGGGCCAGCCAGGGTCAGG No data
1130600232_1130600248 12 Left 1130600232 15:85269346-85269368 CCTGGTGCTGGCGGCCAGCCCTC No data
Right 1130600248 15:85269381-85269403 CCCGGGGGCCAGCCAGGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130600248 Original CRISPR CCCGGGGGCCAGCCAGGGTC AGG Intergenic