ID: 1130600253

View in Genome Browser
Species Human (GRCh38)
Location 15:85269395-85269417
Sequence AGGGTCAGGAGAAGAAAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130600230_1130600253 28 Left 1130600230 15:85269344-85269366 CCCCTGGTGCTGGCGGCCAGCCC No data
Right 1130600253 15:85269395-85269417 AGGGTCAGGAGAAGAAAGCTGGG No data
1130600234_1130600253 12 Left 1130600234 15:85269360-85269382 CCAGCCCTCTGTGGCCCCAGCCC No data
Right 1130600253 15:85269395-85269417 AGGGTCAGGAGAAGAAAGCTGGG No data
1130600236_1130600253 8 Left 1130600236 15:85269364-85269386 CCCTCTGTGGCCCCAGCCCCGGG No data
Right 1130600253 15:85269395-85269417 AGGGTCAGGAGAAGAAAGCTGGG No data
1130600231_1130600253 27 Left 1130600231 15:85269345-85269367 CCCTGGTGCTGGCGGCCAGCCCT No data
Right 1130600253 15:85269395-85269417 AGGGTCAGGAGAAGAAAGCTGGG No data
1130600241_1130600253 -2 Left 1130600241 15:85269374-85269396 CCCCAGCCCCGGGGGCCAGCCAG No data
Right 1130600253 15:85269395-85269417 AGGGTCAGGAGAAGAAAGCTGGG No data
1130600232_1130600253 26 Left 1130600232 15:85269346-85269368 CCTGGTGCTGGCGGCCAGCCCTC No data
Right 1130600253 15:85269395-85269417 AGGGTCAGGAGAAGAAAGCTGGG No data
1130600242_1130600253 -3 Left 1130600242 15:85269375-85269397 CCCAGCCCCGGGGGCCAGCCAGG No data
Right 1130600253 15:85269395-85269417 AGGGTCAGGAGAAGAAAGCTGGG No data
1130600247_1130600253 -9 Left 1130600247 15:85269381-85269403 CCCGGGGGCCAGCCAGGGTCAGG No data
Right 1130600253 15:85269395-85269417 AGGGTCAGGAGAAGAAAGCTGGG No data
1130600238_1130600253 7 Left 1130600238 15:85269365-85269387 CCTCTGTGGCCCCAGCCCCGGGG No data
Right 1130600253 15:85269395-85269417 AGGGTCAGGAGAAGAAAGCTGGG No data
1130600249_1130600253 -10 Left 1130600249 15:85269382-85269404 CCGGGGGCCAGCCAGGGTCAGGA No data
Right 1130600253 15:85269395-85269417 AGGGTCAGGAGAAGAAAGCTGGG No data
1130600244_1130600253 -4 Left 1130600244 15:85269376-85269398 CCAGCCCCGGGGGCCAGCCAGGG No data
Right 1130600253 15:85269395-85269417 AGGGTCAGGAGAAGAAAGCTGGG No data
1130600246_1130600253 -8 Left 1130600246 15:85269380-85269402 CCCCGGGGGCCAGCCAGGGTCAG No data
Right 1130600253 15:85269395-85269417 AGGGTCAGGAGAAGAAAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130600253 Original CRISPR AGGGTCAGGAGAAGAAAGCT GGG Intergenic