ID: 1130611756

View in Genome Browser
Species Human (GRCh38)
Location 15:85367550-85367572
Sequence ATGTTTCCCTAGCAGTATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130611756_1130611758 -2 Left 1130611756 15:85367550-85367572 CCAGGATACTGCTAGGGAAACAT No data
Right 1130611758 15:85367571-85367593 ATGGTCCAAAGACAAAGCCAAGG No data
1130611756_1130611762 18 Left 1130611756 15:85367550-85367572 CCAGGATACTGCTAGGGAAACAT No data
Right 1130611762 15:85367591-85367613 AGGGTGTATCTATAAATCCACGG No data
1130611756_1130611759 -1 Left 1130611756 15:85367550-85367572 CCAGGATACTGCTAGGGAAACAT No data
Right 1130611759 15:85367572-85367594 TGGTCCAAAGACAAAGCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130611756 Original CRISPR ATGTTTCCCTAGCAGTATCC TGG (reversed) Intergenic
No off target data available for this crispr