ID: 1130619328

View in Genome Browser
Species Human (GRCh38)
Location 15:85445278-85445300
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 85}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130619328_1130619333 29 Left 1130619328 15:85445278-85445300 CCTTACCACTGAAAGGGGCTTCA 0: 1
1: 0
2: 0
3: 10
4: 85
Right 1130619333 15:85445330-85445352 GTGGGAGTTACAGGCTTTGATGG 0: 1
1: 0
2: 0
3: 15
4: 156
1130619328_1130619330 10 Left 1130619328 15:85445278-85445300 CCTTACCACTGAAAGGGGCTTCA 0: 1
1: 0
2: 0
3: 10
4: 85
Right 1130619330 15:85445311-85445333 TGCATTTCGAGAGCTCACAGTGG 0: 1
1: 0
2: 0
3: 18
4: 102
1130619328_1130619332 20 Left 1130619328 15:85445278-85445300 CCTTACCACTGAAAGGGGCTTCA 0: 1
1: 0
2: 0
3: 10
4: 85
Right 1130619332 15:85445321-85445343 GAGCTCACAGTGGGAGTTACAGG 0: 1
1: 0
2: 0
3: 10
4: 166
1130619328_1130619331 11 Left 1130619328 15:85445278-85445300 CCTTACCACTGAAAGGGGCTTCA 0: 1
1: 0
2: 0
3: 10
4: 85
Right 1130619331 15:85445312-85445334 GCATTTCGAGAGCTCACAGTGGG 0: 1
1: 0
2: 0
3: 15
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130619328 Original CRISPR TGAAGCCCCTTTCAGTGGTA AGG (reversed) Intronic