ID: 1130619329

View in Genome Browser
Species Human (GRCh38)
Location 15:85445283-85445305
Sequence AGAGATGAAGCCCCTTTCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 207}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130619329_1130619331 6 Left 1130619329 15:85445283-85445305 CCACTGAAAGGGGCTTCATCTCT 0: 1
1: 0
2: 0
3: 21
4: 207
Right 1130619331 15:85445312-85445334 GCATTTCGAGAGCTCACAGTGGG 0: 1
1: 0
2: 0
3: 15
4: 169
1130619329_1130619332 15 Left 1130619329 15:85445283-85445305 CCACTGAAAGGGGCTTCATCTCT 0: 1
1: 0
2: 0
3: 21
4: 207
Right 1130619332 15:85445321-85445343 GAGCTCACAGTGGGAGTTACAGG 0: 1
1: 0
2: 0
3: 10
4: 166
1130619329_1130619330 5 Left 1130619329 15:85445283-85445305 CCACTGAAAGGGGCTTCATCTCT 0: 1
1: 0
2: 0
3: 21
4: 207
Right 1130619330 15:85445311-85445333 TGCATTTCGAGAGCTCACAGTGG 0: 1
1: 0
2: 0
3: 18
4: 102
1130619329_1130619333 24 Left 1130619329 15:85445283-85445305 CCACTGAAAGGGGCTTCATCTCT 0: 1
1: 0
2: 0
3: 21
4: 207
Right 1130619333 15:85445330-85445352 GTGGGAGTTACAGGCTTTGATGG 0: 1
1: 0
2: 0
3: 15
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130619329 Original CRISPR AGAGATGAAGCCCCTTTCAG TGG (reversed) Intronic