ID: 1130619333 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 15:85445330-85445352 |
Sequence | GTGGGAGTTACAGGCTTTGA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 172 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 15, 4: 156} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1130619328_1130619333 | 29 | Left | 1130619328 | 15:85445278-85445300 | CCTTACCACTGAAAGGGGCTTCA | 0: 1 1: 0 2: 0 3: 10 4: 85 |
||
Right | 1130619333 | 15:85445330-85445352 | GTGGGAGTTACAGGCTTTGATGG | 0: 1 1: 0 2: 0 3: 15 4: 156 |
||||
1130619329_1130619333 | 24 | Left | 1130619329 | 15:85445283-85445305 | CCACTGAAAGGGGCTTCATCTCT | 0: 1 1: 0 2: 0 3: 21 4: 207 |
||
Right | 1130619333 | 15:85445330-85445352 | GTGGGAGTTACAGGCTTTGATGG | 0: 1 1: 0 2: 0 3: 15 4: 156 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1130619333 | Original CRISPR | GTGGGAGTTACAGGCTTTGA TGG | Intronic | ||