ID: 1130619333

View in Genome Browser
Species Human (GRCh38)
Location 15:85445330-85445352
Sequence GTGGGAGTTACAGGCTTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 156}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130619328_1130619333 29 Left 1130619328 15:85445278-85445300 CCTTACCACTGAAAGGGGCTTCA 0: 1
1: 0
2: 0
3: 10
4: 85
Right 1130619333 15:85445330-85445352 GTGGGAGTTACAGGCTTTGATGG 0: 1
1: 0
2: 0
3: 15
4: 156
1130619329_1130619333 24 Left 1130619329 15:85445283-85445305 CCACTGAAAGGGGCTTCATCTCT 0: 1
1: 0
2: 0
3: 21
4: 207
Right 1130619333 15:85445330-85445352 GTGGGAGTTACAGGCTTTGATGG 0: 1
1: 0
2: 0
3: 15
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130619333 Original CRISPR GTGGGAGTTACAGGCTTTGA TGG Intronic