ID: 1130620195

View in Genome Browser
Species Human (GRCh38)
Location 15:85453943-85453965
Sequence CTGTGCTGACCCAGAACAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 199}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130620195_1130620200 14 Left 1130620195 15:85453943-85453965 CCTTCTGTTCTGGGTCAGCACAG 0: 1
1: 0
2: 0
3: 13
4: 199
Right 1130620200 15:85453980-85454002 AAAGGCTGGAATGGCAAAGATGG 0: 1
1: 0
2: 5
3: 43
4: 461
1130620195_1130620196 -4 Left 1130620195 15:85453943-85453965 CCTTCTGTTCTGGGTCAGCACAG 0: 1
1: 0
2: 0
3: 13
4: 199
Right 1130620196 15:85453962-85453984 ACAGATTCTCCAAAGCACAAAGG 0: 1
1: 0
2: 2
3: 31
4: 263
1130620195_1130620197 0 Left 1130620195 15:85453943-85453965 CCTTCTGTTCTGGGTCAGCACAG 0: 1
1: 0
2: 0
3: 13
4: 199
Right 1130620197 15:85453966-85453988 ATTCTCCAAAGCACAAAGGCTGG 0: 1
1: 2
2: 26
3: 103
4: 392
1130620195_1130620201 17 Left 1130620195 15:85453943-85453965 CCTTCTGTTCTGGGTCAGCACAG 0: 1
1: 0
2: 0
3: 13
4: 199
Right 1130620201 15:85453983-85454005 GGCTGGAATGGCAAAGATGGTGG 0: 1
1: 0
2: 3
3: 38
4: 411
1130620195_1130620199 5 Left 1130620195 15:85453943-85453965 CCTTCTGTTCTGGGTCAGCACAG 0: 1
1: 0
2: 0
3: 13
4: 199
Right 1130620199 15:85453971-85453993 CCAAAGCACAAAGGCTGGAATGG 0: 1
1: 19
2: 55
3: 128
4: 515

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130620195 Original CRISPR CTGTGCTGACCCAGAACAGA AGG (reversed) Intronic
900519981 1:3100777-3100799 CTGGGCTGACTCAGCACAGCTGG + Intronic
901002928 1:6157638-6157660 CTGAGCTGTCACAGAACAGGAGG - Intronic
901154341 1:7125452-7125474 CTGGGCTGACCTTGAACACACGG - Intronic
901480330 1:9520625-9520647 CTGTGCAGACGCAGCCCAGAAGG - Intergenic
901486634 1:9567874-9567896 CTGTACTGTCCCAGTACATAAGG + Intronic
903173817 1:21569170-21569192 CTGAGCTGACTCAGAAGGGATGG - Intronic
903236967 1:21956520-21956542 CTGTGCTCACCAAGAACACTAGG + Intergenic
903396596 1:23006337-23006359 GTGTGCTGCACCAGAACACAGGG - Intergenic
906415628 1:45619658-45619680 CTGTCCTGACCAAGAAAAGGGGG - Intergenic
911657312 1:100459746-100459768 ATGTGCCGACCCAGAACTTATGG - Intronic
913569319 1:120104461-120104483 CTGAGCTGGCCCAGGAGAGAGGG + Intergenic
915080454 1:153348543-153348565 CTGTGCTGTCCCAGCCCAGCAGG + Exonic
915285813 1:154851335-154851357 GGCTCCTGACCCAGAACAGATGG - Intronic
916025154 1:160827245-160827267 CTGTGCTGACCCAGAGGAGCGGG - Intronic
916298775 1:163250081-163250103 CTGGGCTGACTCAGGACACAAGG + Intronic
918392262 1:184078564-184078586 CTGAGCTTCCCCAGCACAGAGGG - Intergenic
924626856 1:245702675-245702697 CTTTGATGCCCCAGCACAGAGGG - Exonic
924646218 1:245879375-245879397 CTGTGCTGTTACAGAAGAGATGG + Intronic
1066302208 10:34107216-34107238 CAGGGCTGTCCCAGAACAGGCGG - Intergenic
1067350243 10:45469186-45469208 CTGTGCAGCACCAGCACAGATGG - Intronic
1067667957 10:48294598-48294620 CTGAGCTGTCACAGGACAGAGGG + Intergenic
1069850170 10:71398920-71398942 ATATGCGGACCCAGCACAGACGG - Intronic
1069958686 10:72067210-72067232 CTGCCCAGACCCAGAATAGAGGG - Intronic
1073671888 10:105600211-105600233 CTGTGCTGACAATGAAGAGATGG + Intergenic
1076833712 10:133009552-133009574 CTCTGCTGACCTGGAGCAGAGGG - Intergenic
1079643077 11:22830299-22830321 CAGTGCTATTCCAGAACAGAGGG + Intronic
1079885411 11:25982113-25982135 CAGTGCCGACACAGAACAGCTGG + Intergenic
1082818517 11:57527312-57527334 CAGTGCTGACCATGAGCAGACGG + Intergenic
1083996712 11:66276600-66276622 CTGTCCTGCCCAAGAACTGAGGG + Exonic
1084907486 11:72359149-72359171 CTCTTCTTACCCAGCACAGATGG - Intronic
1088231543 11:107678111-107678133 CTGAGCTGAGCCAGAAAAGCTGG - Intergenic
1092101111 12:5884514-5884536 TTGTACTGACCCAGGACAGCCGG + Intronic
1094486869 12:30932585-30932607 CTGTGCCTACCCAAAAAAGAAGG + Intronic
1095900613 12:47324455-47324477 CTGAGCTGAGAAAGAACAGAAGG - Intergenic
1096600352 12:52724472-52724494 CACTGCTGCCCCAGAGCAGAGGG - Intergenic
1096620407 12:52861121-52861143 CTGTCATGACCCAGAAAAGGTGG - Intergenic
1096628151 12:52907649-52907671 CTGGGCTGCCCCAGAAAAAAAGG - Intronic
1098581180 12:72101065-72101087 CTATGCTGACACAGAAATGATGG - Intronic
1102415596 12:112759817-112759839 CTGTGCTGGAGCAGAGCAGAAGG - Intronic
1103327544 12:120131425-120131447 GTGTGCTGACCCAGAGCACAAGG + Intronic
1103508195 12:121455298-121455320 CTGGGCTGCCCCAGAGCAGAGGG - Intronic
1104950312 12:132436990-132437012 CTCTGCTGCCCCCGAGCAGAGGG - Intergenic
1104985302 12:132593251-132593273 CTATGCAGGCCCAGAACAGGCGG - Intergenic
1108327208 13:49345701-49345723 CTGAGCTGAACCAGGGCAGAGGG + Intronic
1110131966 13:72020934-72020956 CTGTGCTGTCCCAGTCCAGGGGG - Intergenic
1113176973 13:107576066-107576088 CAGTCCTGATCCAGAGCAGAGGG + Intronic
1114515640 14:23298124-23298146 CTGTGCTGATCCTGCATAGATGG + Exonic
1121702982 14:95970307-95970329 CTGTGCTGACCCAGCATCAAAGG + Intergenic
1122153719 14:99738128-99738150 CAGAGCTGACCCAGGACAGAGGG + Intronic
1122864057 14:104595575-104595597 CTGTCCTGACCCAGGACGGCCGG + Intronic
1122947084 14:105016713-105016735 TTGGGCTGACCCAGAGCTGAAGG - Intronic
1124070878 15:26392240-26392262 CTGTTCTGCCCAAGAAGAGAAGG - Intergenic
1125088351 15:35759050-35759072 CTGGGCTGCAACAGAACAGAAGG - Intergenic
1125745304 15:41993641-41993663 CTGTCCTGACGCAGAAAAGCTGG - Intronic
1125782291 15:42280487-42280509 TTCTGCTGACCCTGAATAGAAGG - Intronic
1127293515 15:57591100-57591122 CTCTGCTGTCCCCTAACAGAGGG - Intergenic
1128343181 15:66836881-66836903 CGGAGCTGACCCTGAACAGCAGG - Intergenic
1128575327 15:68770403-68770425 CTGTTCTAACCAGGAACAGATGG - Intergenic
1129300985 15:74625371-74625393 CTGTGCTGAGCCTGGGCAGATGG + Intronic
1130080921 15:80732818-80732840 CAGTGCTGAGCCAGAGCTGATGG + Intronic
1130320262 15:82835645-82835667 CTGTGCTGGCCCAGGCCTGATGG + Exonic
1130620195 15:85453943-85453965 CTGTGCTGACCCAGAACAGAAGG - Intronic
1131646867 15:94354203-94354225 AGGTGCTGAGACAGAACAGAAGG - Intronic
1133186895 16:4106394-4106416 CGGTGCTGCCGCGGAACAGAAGG - Intronic
1133820578 16:9232618-9232640 CTGTGCTGGACCAAGACAGACGG + Intergenic
1134250656 16:12571584-12571606 CTGTGCTGAAACAGAACAGCAGG + Exonic
1136566200 16:31072257-31072279 GTGTGGTGACCCAAAACAAATGG + Intronic
1137589624 16:49685677-49685699 CAGTGGGGACCGAGAACAGAGGG - Intronic
1138405837 16:56793295-56793317 TTGAGCTGACCCACAGCAGAAGG + Intronic
1138655805 16:58490610-58490632 CTGTGCTGACTCATGAAAGAGGG - Intronic
1138713566 16:58996555-58996577 CTTTGCTTACCCAGAACAAGGGG - Intergenic
1140847008 16:78900240-78900262 CTGAGCTGACACAAAACAGGAGG - Intronic
1141222834 16:82087793-82087815 CTGTGCTGTTCCACAGCAGAAGG + Intronic
1141481688 16:84310868-84310890 TTGTGCTGGCCCAGTACATAGGG - Intronic
1142861545 17:2765178-2765200 CTGTCCTCATCCAGTACAGATGG + Intergenic
1145234530 17:21199427-21199449 CTTTGCTGACTCAGATCAGTTGG - Intronic
1146380481 17:32323763-32323785 GTGTGCTGACAGAGAACAGCTGG - Exonic
1147215571 17:38897155-38897177 CTGTTCTGATCCAGACAAGAAGG - Intronic
1147242984 17:39102631-39102653 GTGTGCTGAGACAGAACAGTGGG + Intronic
1147650575 17:42059487-42059509 CCGTTCTGACCCAGTACTGAGGG + Intronic
1150306909 17:64093387-64093409 CTGTGTTGAAACTGAACAGATGG - Intronic
1151298771 17:73205888-73205910 CTAGGCTGACTCAGAAGAGAGGG - Intronic
1152651024 17:81493023-81493045 CTTTTCTGACCCAGGACAGCAGG + Intergenic
1154045682 18:10902757-10902779 AAGTGCAGACCCTGAACAGAGGG + Intronic
1154396171 18:13991589-13991611 CAGTGCTTACCAGGAACAGAGGG + Intergenic
1156804162 18:41156328-41156350 CTGTGGGGGCCCAGAAGAGAGGG + Intergenic
1156894337 18:42228440-42228462 CTTTGCTATCCCAGAAAAGACGG + Intergenic
1156914024 18:42444263-42444285 CTGTTCTAACCCAGTACTGAAGG - Intergenic
1157497353 18:48165775-48165797 CTGTGCAGACCCTGCAAAGAGGG - Intronic
1160419604 18:78735098-78735120 CTGGGCAGACCCAGAGCAGGAGG - Intergenic
1160456695 18:79006730-79006752 CTGTGCTGACCCGGAGCCGCCGG + Intergenic
1162135955 19:8555455-8555477 CTGAGCTTCCCCAGGACAGAGGG + Intronic
1166921460 19:46231587-46231609 CTGTTCTGTCCCAGAACTGGTGG - Intergenic
1167199725 19:48056102-48056124 CTGTCCTGAACCAGAGCAAAAGG + Intronic
925924426 2:8660014-8660036 CTGTGATGGCCCAGAGCAGGGGG - Intergenic
926608237 2:14918899-14918921 TTGTCCTGAACCAGGACAGAAGG + Intergenic
927639649 2:24838522-24838544 CTGTGATTACCTAGAAGAGAAGG - Exonic
928933138 2:36645956-36645978 CAGTACTGGCCCCGAACAGAAGG + Intronic
930050830 2:47215152-47215174 CTGTGATTACCCAGACCAGAAGG - Intergenic
930270736 2:49253452-49253474 CTATGGTGACCCAGGATAGAGGG + Intergenic
931893311 2:66700100-66700122 CTGTGGTGACTGAGAAAAGAGGG + Intergenic
933725722 2:85426048-85426070 CTGGGCTCACCAAGAACAGAAGG - Intronic
934036419 2:88092242-88092264 CTGTGCTGTCTCAGAAAAGGGGG - Intronic
940191000 2:151039822-151039844 CTGAGTTGACCCAGAAGACAGGG + Intronic
943144560 2:184025533-184025555 CTGCGTTGACCCAGAACATTTGG + Intergenic
944761762 2:202822904-202822926 CTGACCTGATCCAGAGCAGATGG + Intronic
945505523 2:210635411-210635433 CAGTGCTGCCCCAGAAGATAAGG - Intronic
946685203 2:222261541-222261563 CTCTTCTGAGGCAGAACAGAGGG + Intronic
948149775 2:235736048-235736070 CTGTGCTTCCCCAGGACACAAGG - Intronic
948615295 2:239194686-239194708 CTGTGCTGTCACAGAATGGAAGG - Intronic
1168737701 20:157435-157457 ATGCACTGAACCAGAACAGATGG - Intergenic
1169423475 20:5477959-5477981 CTGTGCTGAGCTGGGACAGAGGG - Intergenic
1169424516 20:5485630-5485652 ATGGGCTGAGCCTGAACAGAGGG + Intergenic
1169424755 20:5487111-5487133 CCGTGCTGAGCAAGGACAGAGGG - Intergenic
1169937393 20:10898677-10898699 CTGTGCTGACACTGAAAAGCTGG + Intergenic
1172028041 20:31962823-31962845 CTGTTCAGACCCAGAACCCAAGG - Intergenic
1175169585 20:57070613-57070635 CAGGGCTGACCCCAAACAGATGG + Intergenic
1179230876 21:39502771-39502793 CTGTGTCCAGCCAGAACAGAGGG - Intronic
1179954817 21:44732754-44732776 CTGTGCTGACCCTGGTCAGTTGG - Intergenic
1182251661 22:29005523-29005545 CTCTGCTGACCCAAAAGACATGG - Intronic
1182771634 22:32801074-32801096 CTGTGCTCTCCCAGAGCAAACGG - Intronic
1184019845 22:41813606-41813628 CTGTGCTGACCCAGTTCCCATGG + Intronic
1184147936 22:42622469-42622491 GTGGGCTGACCCAGGACAGCAGG + Intronic
1184433046 22:44452836-44452858 CTGTTATGCCCCAGAACAGCCGG + Intergenic
1184445154 22:44542793-44542815 CTGCTCTGAGCCTGAACAGACGG + Intergenic
1184687366 22:46102681-46102703 CTGGGCTCACCCAACACAGAAGG + Intronic
1184790465 22:46696644-46696666 CTGTGCTGCTCCAGAACAACCGG + Intronic
1184801332 22:46762327-46762349 CGGAGCCGGCCCAGAACAGAGGG - Intergenic
1185114040 22:48921030-48921052 CCGTTCTGACACAGAGCAGATGG + Intergenic
950496705 3:13338173-13338195 CAGTGCTGACCTGGAACAGCTGG - Intronic
950971241 3:17190499-17190521 CTGAGCTGAGCCAGAACATGGGG + Intronic
951602103 3:24387970-24387992 CTGTGTTGCCCCTGAACACAAGG - Intronic
952873749 3:37924764-37924786 CTGTGCAGACCCAGTGCCGATGG + Intronic
953118184 3:40013435-40013457 CTGTGCTGGTTCAGAAGAGAAGG + Intronic
953658284 3:44871433-44871455 ATGTGCTGTCCCAGAAAAGTTGG - Intronic
953963404 3:47283505-47283527 CTGTGCTGTTCTAGAAGAGAAGG + Intronic
955393385 3:58537126-58537148 CAGTGCGGACACAGGACAGAGGG - Exonic
955933105 3:64077463-64077485 CAGAGCTGACCCAGGACAGGAGG + Intergenic
956482915 3:69690621-69690643 CTTTGCTGATCAAGTACAGAAGG + Intergenic
960171992 3:114472975-114472997 CTGTGCTGAGTCTGCACAGAAGG + Intronic
961091558 3:124117187-124117209 CTGAGCTGATGCAGATCAGAAGG - Intronic
961337220 3:126187821-126187843 AAGAGCAGACCCAGAACAGAAGG + Intronic
961351738 3:126308504-126308526 CAGTGCTGACACAGAGCTGAGGG + Intergenic
961575384 3:127831782-127831804 GTGTGCTGACCCAGGAGAGTGGG + Intergenic
962422225 3:135238829-135238851 CTGGGCTCCCCCAGAAAAGAGGG - Intronic
962985446 3:140531827-140531849 TTGTGGTTTCCCAGAACAGAGGG + Intronic
962989780 3:140567217-140567239 CTGGGCTCCCCCAGGACAGAGGG + Exonic
964096034 3:152932889-152932911 CTGCCCAGACCCAGAAGAGAAGG + Intergenic
964276504 3:155013808-155013830 CTGAGCTGGCACAGAAGAGATGG - Intergenic
964494871 3:157277559-157277581 AAGTGCTGAACCACAACAGATGG - Intronic
965317674 3:167211654-167211676 CTGAACTGACCCAGGGCAGAAGG + Intergenic
966783053 3:183601586-183601608 CCTTGCTTCCCCAGAACAGAGGG + Intergenic
967124036 3:186408808-186408830 CTGTGCTGGCACAGGAGAGATGG + Intergenic
967136569 3:186517399-186517421 CTGGGCTGACTCACAACAGTTGG + Intergenic
969058987 4:4420253-4420275 CTGTGCTTACCTTGAATAGATGG + Intronic
972316738 4:37934050-37934072 CACTGCTCACCCAGAACACACGG - Intronic
975383480 4:73728884-73728906 CTTTCCTCACCCTGAACAGATGG + Intergenic
975570761 4:75815507-75815529 CTGGGCTGACCCAGAGGAAAGGG - Intergenic
977772517 4:100876376-100876398 CTTTGTTGACCCAAAACACAAGG - Intronic
978208130 4:106104405-106104427 CTGAGCTGACTCAGAGCAGAAGG + Intronic
978651650 4:111012779-111012801 TTCTGCTGATCGAGAACAGAAGG - Intergenic
978976399 4:114880093-114880115 CTGTTCTAACTGAGAACAGAAGG + Intronic
979108828 4:116724036-116724058 CTATGCAGGCCCAGAAAAGATGG + Intergenic
981478434 4:145211228-145211250 CTGTGCTGCCCCAGAATGTATGG + Intergenic
981901859 4:149874941-149874963 CTGTACTGACAAAGAACAAATGG - Intergenic
987212911 5:15702269-15702291 AAGTGCTGACTCAGAACTGAAGG + Intronic
987315709 5:16721375-16721397 CTTTCCTGACCTTGAACAGAAGG + Intronic
992151423 5:73908307-73908329 CTGAGCTGACAAAGAACATATGG + Intronic
992397106 5:76378363-76378385 CTGGGCTGACCCCGGATAGAAGG + Intergenic
997243066 5:132322382-132322404 GTGTGCTGACCCGCAGCAGAGGG - Intronic
997349985 5:133223937-133223959 CTCTGCTGAAGCAGAACAGTTGG - Intronic
1000068562 5:157718519-157718541 CTGTGTTGTCCCAGAAAGGAAGG - Intergenic
1002852587 6:1009907-1009929 CTGTGCAGACAGAGAACAGGTGG - Intergenic
1004549789 6:16635879-16635901 CTGTGCTTCCCCAGCACAGTGGG - Intronic
1005585460 6:27272642-27272664 CTGTCCTTCCCCACAACAGAGGG - Intergenic
1006596003 6:35192797-35192819 CTATGCACACCCAGCACAGACGG - Intergenic
1008192386 6:48475725-48475747 CTGTGCTTACCCTGAACTGTAGG + Intergenic
1010427809 6:75746469-75746491 CTTTTGTGTCCCAGAACAGACGG - Intergenic
1013015447 6:106156948-106156970 GTGTGCTTACCCAGAACCGAAGG + Intergenic
1013393046 6:109705951-109705973 ATGTGCTTACCCAGAAAAGCTGG + Intronic
1019357923 7:590621-590643 CTGCTCTGACCCAGAGCTGATGG - Intronic
1019498377 7:1352073-1352095 CCGAGCTGGCCCAGAGCAGATGG + Intergenic
1021952030 7:25784615-25784637 GTGTTCTGACCCAAATCAGATGG + Intergenic
1023606405 7:41935332-41935354 CTGTGCTGAGCCATCACATATGG + Intergenic
1029595657 7:101536324-101536346 CTTTGATGGCCCAGATCAGAGGG + Intronic
1029728778 7:102425817-102425839 CTGGGCTGAGCCAGAGCAGAAGG + Exonic
1030608607 7:111665054-111665076 GTGTGCTGACCCAGACAAAATGG + Intergenic
1034031039 7:147763956-147763978 CAGTGCTGAGTCAAAACAGAAGG + Intronic
1035255389 7:157622632-157622654 CTGTGCTGGCCCAGCTCACACGG + Intronic
1035328048 7:158077522-158077544 CTGTGCTGACCCTGAATGGTGGG - Intronic
1035571703 8:676619-676641 GTGTGCAGGCCAAGAACAGACGG + Intronic
1038443255 8:27586176-27586198 CTGAGCTGACCCAGTAAAGTGGG - Intergenic
1039191275 8:34978577-34978599 GTGTGCTGACTCTGAGCAGATGG - Intergenic
1039821404 8:41138517-41138539 CTGTGACGTCCCAAAACAGAGGG + Intergenic
1041097518 8:54364293-54364315 CATTGCTGAACCAGAGCAGAGGG + Intergenic
1044319762 8:90789600-90789622 CTGTGCTGTGTCAGAACAGTTGG - Intronic
1046805216 8:118472797-118472819 CATTGCTGACTCAGAATAGAAGG + Intronic
1046813226 8:118555114-118555136 CTCTGCTAACCAATAACAGATGG - Intronic
1048208320 8:132433330-132433352 TTGTTCTGACCCAGCAGAGAAGG + Intronic
1048905230 8:139081484-139081506 CTGCTCTGATCCAGCACAGAAGG + Intergenic
1048907766 8:139104842-139104864 CTGTGGGCACCCAGAAGAGATGG - Intergenic
1049339831 8:142106125-142106147 GTGTGGTGGCACAGAACAGAGGG + Intergenic
1049709042 8:144055501-144055523 CTGGCCTGACCCTGCACAGATGG + Intronic
1057827762 9:98383821-98383843 ATGTGCTGTCCCAGAGCAGAGGG + Intronic
1058825439 9:108772225-108772247 CTCTGCTGCCCCAAAACAGATGG + Intergenic
1059534745 9:115070252-115070274 CAGATATGACCCAGAACAGAGGG - Intronic
1060502593 9:124173304-124173326 CTGTGCTGAATCCCAACAGAGGG - Intergenic
1061394588 9:130337113-130337135 CTGTGCGGAGCCAGCACATATGG + Intronic
1062016394 9:134293373-134293395 CTGTGCTCACCCCAAACACATGG + Intergenic
1062712283 9:137982757-137982779 ATGTGATCACCAAGAACAGATGG + Intronic
1190995107 X:55599886-55599908 CTGTGCAGACACAGAACTGCTGG - Intergenic
1193858863 X:86639784-86639806 CTGAGCTGACCCAGGGCAGAAGG + Intronic
1198326540 X:135579254-135579276 CTTTTCTGACACAGAAAAGAAGG + Intronic