ID: 1130633739

View in Genome Browser
Species Human (GRCh38)
Location 15:85596670-85596692
Sequence TTCAGTGTTTGTACTGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 234}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130633739 Original CRISPR TTCAGTGTTTGTACTGAAGA TGG Intronic
900276014 1:1828951-1828973 TTCTATGTGTGGACTGAAGAGGG - Intronic
902173101 1:14629015-14629037 TTTTGTGTTTTTACTGGAGACGG + Intronic
905931747 1:41792764-41792786 TTCAGTGTATGCAATGAAGGTGG - Intronic
908553760 1:65236060-65236082 TTTACTGTATCTACTGAAGAGGG + Intergenic
911260077 1:95675153-95675175 TTCACCATTTGTACTAAAGATGG - Intergenic
911425848 1:97710956-97710978 TTCAGTGTTGGTATTTAAAAAGG - Intronic
912271977 1:108220768-108220790 TTCTGTGTTTGTACTGGAGGTGG + Intergenic
914492405 1:148160576-148160598 TACAGTCTTTGGACAGAAGATGG - Intergenic
915093262 1:153441357-153441379 TTCAGTGTTTATACTGCCCAGGG + Intergenic
915234131 1:154468076-154468098 TTTTGTTTTTGTATTGAAGAGGG + Exonic
918545101 1:185673282-185673304 TTCCTTGTTTGTCCTGAGGAAGG - Intergenic
918652286 1:186980118-186980140 TTTTGTGTTTGTAGTGAAGACGG + Intronic
919616314 1:199813139-199813161 TTCATGGTTTCTACTGCAGAAGG + Intergenic
919734760 1:200939781-200939803 TTTTGTGTTTTTAGTGAAGATGG + Intergenic
921736928 1:218639328-218639350 TTCAGTGTTTGTAGTCAAAAAGG - Intergenic
923350115 1:233096440-233096462 TTCAGTGGTTTGACTGGAGATGG + Intronic
924166799 1:241291912-241291934 TTCGGTGATTGTACTACAGATGG - Intronic
1063843575 10:10100844-10100866 TTCAGTGTTAACACTGAAGATGG - Intergenic
1068165157 10:53321283-53321305 TTCAGTGTCTGTAGTGGAGGAGG - Intergenic
1068964250 10:62895814-62895836 TTTTGTGTTTGTAGTAAAGATGG - Intronic
1069935516 10:71913041-71913063 CTCAGTGTGTGTACTGAAGTTGG + Intergenic
1071091091 10:81919581-81919603 TTGTGTGTTTGTATTAAAGATGG + Intronic
1072573626 10:96679763-96679785 TTGAGAATTTGTGCTGAAGATGG - Intronic
1074598211 10:114886929-114886951 TTCTCTGTTTTTACAGAAGAAGG + Intronic
1077751944 11:4981108-4981130 TTTAGAGAGTGTACTGAAGATGG + Intronic
1078626179 11:12960848-12960870 TTCAGTGTTAGTAGTGAAAGTGG + Intergenic
1079149725 11:17886645-17886667 TGAACTGTTTATACTGAAGAAGG - Intronic
1079646345 11:22868038-22868060 TTGAGTTTTAGTACTGAACAAGG + Intergenic
1079934633 11:26601637-26601659 TACAGTGTCTGTGCTGAAAATGG - Intronic
1084346346 11:68552221-68552243 TTCAAAGTTTGTCCTGAAGCTGG + Intronic
1088834452 11:113566295-113566317 TTCAGTGCTTGTACTGGAGGAGG + Intergenic
1091101262 11:132875950-132875972 GTCAGAGTTTGCACTTAAGAAGG + Intronic
1092558990 12:9589656-9589678 TTCTGTGTTTCTAGTGGAGATGG - Intergenic
1093173518 12:15885091-15885113 TTCATTGTTTAAACTGATGAAGG + Intronic
1093553146 12:20438963-20438985 TTTTGTGTTTTTAGTGAAGACGG + Intronic
1094747270 12:33359137-33359159 TTCAGTGTTCTTAGTGGAGAAGG - Intergenic
1095852325 12:46824343-46824365 TCCAGTGTTTTAAATGAAGATGG + Intronic
1096280497 12:50248748-50248770 TTCAGTGTCTGTAGACAAGATGG - Exonic
1096980322 12:55724905-55724927 TTCAGTGTCTGTACTGGGAATGG + Intergenic
1100514122 12:95309713-95309735 TTCAGTGTTCATAATGAACAAGG - Intergenic
1101908513 12:108845785-108845807 TTCTGTGTCCGTACTGGAGATGG - Intronic
1107153414 13:37139120-37139142 TTCAGTGTTGGGACAGAAGATGG + Intergenic
1107340614 13:39401349-39401371 TTCACTGTTTCCACTTAAGAGGG + Intronic
1107541223 13:41390953-41390975 TTCATAGTATGTACTGAACAGGG - Intergenic
1108208977 13:48119155-48119177 TTTTGTGTTTTTACTAAAGATGG + Intergenic
1109581645 13:64347040-64347062 TTCTGTGTTTGTAGTAGAGACGG - Intergenic
1109771431 13:66979413-66979435 TTCACTGTTTATAATGAATAAGG - Intronic
1110505885 13:76285467-76285489 TACAGTGTGTTTACTGAAGTTGG - Intergenic
1111717952 13:91904373-91904395 TTCATTGTTTCTAATTAAGAAGG - Intronic
1111727203 13:92027507-92027529 TTCAGTGTTTGAAATGTACAAGG + Intronic
1111871773 13:93842109-93842131 TTCATTGTTTTTAATGAAAATGG + Intronic
1112100740 13:96186476-96186498 CTCAGTGTTTGTTCTGTGGATGG + Intronic
1112136282 13:96581855-96581877 CTGAGAGTTTGTACTGAAGTGGG + Intronic
1112763199 13:102713404-102713426 TTTTGTGTTTTTAGTGAAGACGG + Intergenic
1112776970 13:102854912-102854934 TTCTGTGTTTGAAGTGAAGGTGG + Intronic
1112867114 13:103917941-103917963 TTCAGAGTTTGTACTAATGAGGG - Intergenic
1115125767 14:29991642-29991664 TTCATTGATTGTATTGAAAATGG + Intronic
1115252073 14:31359554-31359576 TTTTGTGTTTTTACTAAAGATGG - Intronic
1115451219 14:33549877-33549899 TTCAGTGCTATCACTGAAGAGGG - Intronic
1116783093 14:49258040-49258062 TTCATTGTTTGGAAAGAAGATGG - Intergenic
1116989820 14:51263485-51263507 TTCAGTGTTTTTAATAAAGCAGG + Intergenic
1117604934 14:57418830-57418852 TTTAGTGTTTTTAGTAAAGACGG + Intergenic
1118115705 14:62774218-62774240 TTCTGGTTTTGTACTGGAGATGG + Intronic
1119191108 14:72682589-72682611 TTCAGTGGTGCTAGTGAAGAGGG - Intronic
1119358492 14:74027255-74027277 TTTTGTGTTTGTAGTAAAGACGG + Intronic
1123738427 15:23209771-23209793 TTCACTGTTTGTGATTAAGAAGG - Intergenic
1124289637 15:28438435-28438457 TTCACTGTTTGTGATTAAGAAGG - Intergenic
1124293584 15:28478876-28478898 TTCACTGTTTGTGATTAAGAAGG + Intergenic
1126916542 15:53472706-53472728 TACAGTGTTTGGAATGTAGAAGG + Intergenic
1127177799 15:56380026-56380048 TTCAGTGTTAATACTGATAAGGG + Intronic
1130633739 15:85596670-85596692 TTCAGTGTTTGTACTGAAGATGG + Intronic
1134467988 16:14495886-14495908 TTCACTGTTTCCTCTGAAGAGGG + Intronic
1134506981 16:14815723-14815745 TTAAGTGTTTGTAGTAGAGACGG + Intronic
1134573580 16:15313103-15313125 TTAAGTGTTTGTAGTAGAGACGG - Intergenic
1134728845 16:16443212-16443234 TTAAGTGTTTGTAGTAGAGATGG + Intergenic
1136509083 16:30724768-30724790 GTCAGTGTCTGCACTGAAGCTGG - Exonic
1136709040 16:32218215-32218237 TTCACTGGTTGTAGTTAAGAAGG + Intergenic
1136758869 16:32711209-32711231 TTCACTGGTTGTAGTTAAGAAGG - Intergenic
1136809238 16:33159175-33159197 TTCACTGGTTGTAGTTAAGAAGG + Intergenic
1136815714 16:33269255-33269277 TTCACTGGTTGTAGTTAAGAAGG + Intronic
1137638849 16:50010722-50010744 TTTTGTGTTTTTAGTGAAGATGG - Intergenic
1137849897 16:51731292-51731314 TTTAGTGTGTCTACTGAGGAGGG + Intergenic
1139200648 16:64973233-64973255 TTCATTCATTGTACTGAATAAGG - Intronic
1141707241 16:85673502-85673524 TTTAGTGTTTGTACTGCTGCTGG + Exonic
1203061025 16_KI270728v1_random:971534-971556 TTCACTGGTTGTAGTTAAGAAGG - Intergenic
1142528869 17:565229-565251 TTTTGTGTTTTTAGTGAAGACGG - Intronic
1143909535 17:10236294-10236316 TTTTGTGTTTTTAGTGAAGACGG - Intergenic
1146338680 17:31999016-31999038 TTCAGTGTTTGTCCATAACATGG - Exonic
1146926280 17:36748034-36748056 TCCACAGTTTGTGCTGAAGAAGG + Intergenic
1147204447 17:38826658-38826680 TTTTGTGTTTGTAGTAAAGATGG + Intergenic
1147800337 17:43081167-43081189 GTCTGTGTTTAGACTGAAGATGG + Intronic
1149207733 17:54267767-54267789 TTCATTGTTTTTACTCAAGCAGG + Intergenic
1149776154 17:59358777-59358799 TTTTGTATTTTTACTGAAGATGG + Intronic
1151311327 17:73294178-73294200 TTCTGTGTTTTTAGTGGAGATGG - Intronic
1151994839 17:77602031-77602053 CCCAGTATTTGTGCTGAAGATGG + Intergenic
1152116463 17:78390627-78390649 TTCAGTGTGTGACCTCAAGAGGG - Intronic
1153117856 18:1682808-1682830 TTCAGAGTTTGCATTGGAGAGGG + Intergenic
1158662424 18:59400535-59400557 TTCATTCTTTGTAGTGAAAATGG + Intergenic
1158844524 18:61427832-61427854 TTTAGTTTTTGTAGAGAAGAGGG - Intronic
1159408237 18:68034406-68034428 TTCAGAGTGAGTAGTGAAGAAGG - Intergenic
1161347071 19:3773774-3773796 TTTTGTATTTTTACTGAAGATGG + Intergenic
1161635023 19:5382817-5382839 TGCAGGGTTTGAACTGAGGATGG - Intergenic
1162196602 19:8989665-8989687 TTTTGTATTTGTAGTGAAGACGG - Intergenic
1164001230 19:21101311-21101333 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164007994 19:21169514-21169536 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164239620 19:23373072-23373094 ATCTGGGTTTGTAGTGAAGAAGG - Intronic
1164253284 19:23503658-23503680 CTCTGGGTTTGTAGTGAAGAGGG - Intergenic
1164297140 19:23922048-23922070 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164317628 19:24107842-24107864 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1166201567 19:41240793-41240815 TTCAGTGTTTGCAATGTGGAAGG - Intronic
1167159681 19:47759026-47759048 TTTAGTATTTTTATTGAAGATGG + Intergenic
1167940054 19:52939512-52939534 TTTAGTGTTTTTACTAGAGACGG + Intronic
925214662 2:2084271-2084293 TTCAGTTCTTGTCCTAAAGAAGG + Intronic
925995044 2:9285351-9285373 TTCAGTGTTTGAAGTGGGGATGG - Intronic
926998628 2:18768642-18768664 GTTAGTCATTGTACTGAAGATGG + Intergenic
927538634 2:23886449-23886471 TTCAATCTTTTTATTGAAGATGG + Intronic
928234674 2:29529273-29529295 TTCCGTGTTTGTAGTAACGAGGG - Intronic
928748380 2:34442463-34442485 TTCAGTGGATGAACTGAAGTTGG - Intergenic
929621637 2:43360581-43360603 ATCAGTGTTTGAGCTGAAGTAGG - Intronic
929672351 2:43886818-43886840 TTTAGTGATTGCACTGAAGCAGG - Exonic
935734480 2:106095962-106095984 TTCAGTGTGTCTACTGAAGGGGG - Intronic
937684810 2:124683785-124683807 TTCTGTTTTTGTCTTGAAGAGGG - Intronic
942343448 2:174975508-174975530 TTTCGTGGTTGTATTGAAGAAGG - Intronic
942349347 2:175036751-175036773 TTCAGTGCGTGTACTGAAACAGG - Intergenic
943072533 2:183157535-183157557 TTCAGAGTTTTGACTAAAGAGGG + Intronic
943092324 2:183389989-183390011 TGCAGTGTTTGTACAGGAGCAGG + Intergenic
943167303 2:184346073-184346095 ATCAGTGTTTCTACTGATGATGG - Intergenic
944109697 2:196119106-196119128 ATCAGTTCTTGTACTGGAGAAGG - Intergenic
945260503 2:207838522-207838544 TTAAGTGTTTGCACAAAAGATGG - Intronic
948956498 2:241296707-241296729 TTCAGTGTTTATAATGGTGAGGG + Intronic
1170786267 20:19470210-19470232 TTGAGTGGTTGTACAGCAGATGG - Intronic
1172830335 20:37828699-37828721 TTCAGTGTTTGTGAAGAATAGGG + Intronic
1173274740 20:41569978-41570000 CTCAGTGCTTGGACTGATGATGG - Intronic
1174904137 20:54532362-54532384 TTCTGTGTTTATAGAGAAGAAGG + Intronic
1175694677 20:61092781-61092803 TTCAGAGTTTGTGGTGAACAGGG + Intergenic
1177405026 21:20655863-20655885 TTCAGTGTTTGTATTCTACATGG + Intergenic
1177466570 21:21490575-21490597 TTCTATGTATGTACTGAATAGGG + Intronic
1177473587 21:21590481-21590503 TTCAGTGTATGGTGTGAAGAAGG - Intergenic
1178144774 21:29726728-29726750 TTAAATGTTTGTACATAAGAAGG - Intronic
1179510109 21:41866939-41866961 TTCCCTGTTTGTACTGAGAAGGG - Intronic
1180327653 22:11445494-11445516 TTCAGTGTTTTTATTAAAAAAGG + Intergenic
1180671193 22:17554869-17554891 TTCTGTGTTTGTGCAGAAGCAGG + Intronic
950713968 3:14834725-14834747 TTCATTTTTTGTTCTGTAGAGGG + Intronic
951633696 3:24749520-24749542 TTCATTGGTTTTACTGAGGAAGG + Intergenic
951752178 3:26048578-26048600 TTCAGTGTTAGAATTGGAGAAGG + Intergenic
954472519 3:50709887-50709909 TTCAGTGTTTTTATTGCAAAAGG + Intronic
957708136 3:83816609-83816631 TTCATTGATGGTACTGATGAGGG + Intergenic
959271675 3:104219855-104219877 TTCATTGTTTTTTATGAAGATGG + Intergenic
959817145 3:110687101-110687123 TTCAGTCTTTGCACTTAACAGGG - Intergenic
960481820 3:118200778-118200800 GTCAGTGTGTGTGCTGAACAGGG + Intergenic
960934418 3:122888795-122888817 TTCAGTGTGTGTGTTGAAGGTGG + Intergenic
961985734 3:131131387-131131409 TTGAATGTATTTACTGAAGATGG + Intronic
963721488 3:148866925-148866947 TTTTGTGTTTTTAGTGAAGACGG + Intronic
963732948 3:148990504-148990526 TTCTGTGTTTGGACTGGGGATGG + Intergenic
964369538 3:155985413-155985435 TTCTGTGTTTTTAGTGGAGACGG + Intergenic
965141145 3:164836299-164836321 TACATTGTTTATAGTGAAGATGG - Intergenic
965504559 3:169498491-169498513 TTCAGTGTTTATACAGAAAAGGG + Intronic
966431718 3:179838814-179838836 TTGATTGTTTTTACTTAAGAAGG + Intronic
971488103 4:27182139-27182161 TTCAGGGTTTGCAGTGAAAATGG - Intergenic
974904032 4:68034495-68034517 TCCACTGTGTGTAATGAAGAGGG - Intergenic
974939092 4:68442421-68442443 TTCAGAGTTTGTTCTTGAGAGGG + Intergenic
975652013 4:76603005-76603027 TTCTGTATTTGTACTAAAGATGG + Intronic
976384633 4:84441969-84441991 CTCAGTGTTTGTTCTGCAGAAGG - Intergenic
977319747 4:95498467-95498489 TTCAGTGTTTTTAGAAAAGATGG - Intronic
977848677 4:101797954-101797976 TTCAGTGTTGGTAGAGAAGGAGG + Intronic
978229236 4:106378312-106378334 TTCCAGGTTTCTACTGAAGAGGG - Intergenic
978646034 4:110932671-110932693 GTCAGTGATTTTACTGAATAAGG - Intergenic
979459959 4:120970684-120970706 TTCAGTGGCTGTCCTAAAGAAGG - Intergenic
979915942 4:126433648-126433670 TTTAGTGTCTGTATAGAAGATGG - Intergenic
980525461 4:133986463-133986485 TTAAGTATTTGTCCTGAATAGGG - Intergenic
982677629 4:158394295-158394317 TTTAGTGTTTGAAGTGAAGGAGG + Intronic
983807167 4:172009031-172009053 TTTAGTATTTCTAGTGAAGATGG - Intronic
985264843 4:188147911-188147933 TGCAGTGTTTGTACTCAGGAAGG + Intergenic
987549859 5:19365480-19365502 TGCTGTGTTTGTAGTGATGATGG - Intergenic
987722479 5:21656386-21656408 TTCAGTCTTAGTATTGAAAATGG + Intergenic
987888332 5:23841192-23841214 TTTAGTGTTTAGACTGAACAGGG + Intergenic
990558679 5:56962197-56962219 GCCAGTGTTTGTAATGAATAAGG - Intronic
991620941 5:68544984-68545006 GTCAGTGTGTGTAGTGAAGATGG - Intergenic
991863294 5:71032055-71032077 TTTTGTGTTTTTACTGGAGACGG - Intergenic
993308563 5:86299242-86299264 TTCTGTGTTTGTACTGGAGGTGG - Intergenic
993331279 5:86603588-86603610 TTCATCGTTTCTACTGAAGATGG + Intergenic
994812275 5:104535729-104535751 GTCAGTGTTTTTTCTTAAGATGG - Intergenic
995786008 5:115828641-115828663 TTAAGTTTTTGTACAGCAGAAGG - Exonic
995876849 5:116799400-116799422 TACAGTGTTAGCAGTGAAGAAGG + Intergenic
996128752 5:119755365-119755387 CACAGTGTTTGTACTGTAGCAGG - Intergenic
996139189 5:119884648-119884670 TGCTGTGTTTGTACTTAAAATGG + Intergenic
998578947 5:143349870-143349892 TGCGGTGATGGTACTGAAGAGGG + Intronic
1001785467 5:174408994-174409016 TTTTGTGTTTTTACTGGAGACGG + Intergenic
1002436902 5:179237079-179237101 TTTAGTTTTTGTAGTGATGAGGG - Intronic
1004975198 6:20957798-20957820 TTCTGTGTTTTTACTAGAGACGG - Intronic
1005218285 6:23556845-23556867 TTTAGAGTTTGTTCTGAAGATGG - Intergenic
1005456387 6:26023680-26023702 ATGAGTGTTAGGACTGAAGAAGG - Intergenic
1007698252 6:43747377-43747399 TTCAGAGTTGGTATTGAGGATGG + Intergenic
1009402368 6:63271969-63271991 TTCAGTGTTTGAAGTGAAAAAGG - Intergenic
1012511582 6:100008864-100008886 TTCAGAATTTGTACAGAAAATGG + Intergenic
1012712080 6:102619461-102619483 TTAAGTGTTTCTACTGATGTTGG - Intergenic
1013686731 6:112593432-112593454 TTCAGTGTTCATACTGAATTAGG + Intergenic
1013752117 6:113419006-113419028 TTCAGTGATAGTAATAAAGATGG + Intergenic
1015112983 6:129614931-129614953 TGCAGAGTTTGGACTCAAGATGG + Intronic
1016091492 6:139984685-139984707 TTCACCGTTTATACTCAAGATGG + Intergenic
1016701241 6:147056621-147056643 TTCTGTTTTTGTTATGAAGATGG + Intergenic
1016720044 6:147285998-147286020 TTAAATGTTTGCTCTGAAGAAGG - Intronic
1018630872 6:165821325-165821347 TTCAGTTTTTGTTCTGAAGGGGG - Intronic
1022036325 7:26537985-26538007 TTCTTTATTTGTAATGAAGATGG + Intronic
1024292830 7:47817697-47817719 TTTAGTGTTTTTAGTAAAGACGG - Intronic
1028479930 7:91293376-91293398 TTCTGTGTTTATACTGATGGTGG - Intergenic
1028783211 7:94761417-94761439 CTCACTGTTTGAACTGGAGATGG + Intergenic
1029591101 7:101507587-101507609 TTTAGTGTTTGTAATAGAGATGG + Intronic
1030138010 7:106276670-106276692 TTTTGTGTTTTTAGTGAAGACGG - Intronic
1030497545 7:110318302-110318324 TTGAGTGTTTGTATTGGAGATGG - Intergenic
1030666131 7:112280796-112280818 TTTTGTGTTTGTAGTGGAGATGG + Intronic
1031768737 7:125814747-125814769 GTCAGTGTTTGTGCATAAGAAGG + Intergenic
1031829820 7:126613233-126613255 GTCATTGTTTGTACTGAAACTGG + Intronic
1032372907 7:131377879-131377901 TGAAGTTTTTGTAATGAAGAAGG + Intronic
1032851741 7:135801242-135801264 CTCAGTGTTTGTACACAAGATGG + Intergenic
1036557833 8:9875535-9875557 TTCAGTGACTGTATTGAACATGG + Intergenic
1036616981 8:10395874-10395896 TTCAGCTTTTGTACAGAAGGGGG - Intronic
1038024381 8:23575927-23575949 TTCAGTGGTCATACTGAAGGTGG - Intergenic
1038265129 8:26033398-26033420 TTCTGTATTTTTACTAAAGATGG + Intronic
1038669289 8:29569464-29569486 CTCAGTGTCTTTCCTGAAGAAGG - Intergenic
1038919282 8:32064863-32064885 TTCAGTATCTGTACTTAAAATGG - Intronic
1039012150 8:33105619-33105641 GCCAGTATATGTACTGAAGAAGG + Intergenic
1039548354 8:38425856-38425878 TTCAGAGTCTGTCCTGAAGGAGG - Intronic
1040576718 8:48658842-48658864 TTCAGTGCTTGTACTGAGCAAGG - Intergenic
1041216361 8:55605282-55605304 TACATTGTTAGTACTGTAGATGG + Intergenic
1042895170 8:73658740-73658762 TTTTGTATTTGTAGTGAAGACGG - Intronic
1042911531 8:73832369-73832391 TTCAGTTTTTGTACATAACAAGG - Intronic
1042926589 8:73973598-73973620 TTCTGTGTTTTTAGTGAAGACGG + Intronic
1043120978 8:76323493-76323515 TTCAGTTTTTATACTGAAATGGG - Intergenic
1043624687 8:82241779-82241801 TTTTCTGTTTGTAATGAAGATGG - Intergenic
1044517129 8:93152590-93152612 TTACTTGTTTATACTGAAGAGGG - Intronic
1045729065 8:105213324-105213346 ATCAGTGATTGTCTTGAAGAAGG - Intronic
1046207705 8:111023149-111023171 TTCAGTGTTGGAAGTGAAGCTGG - Intergenic
1048040283 8:130720988-130721010 TTCAGTCTCTGTTCTTAAGAAGG + Intergenic
1048252367 8:132877308-132877330 TTTTGTGTTTTTACTGGAGACGG + Intronic
1048670201 8:136710483-136710505 TCCAGTGTTTGGACTACAGAAGG + Intergenic
1049495059 8:142926160-142926182 TTCAGAGCATGGACTGAAGAAGG - Intergenic
1050753651 9:8972677-8972699 TTCAGTTTTCTTACTGAAAAAGG - Intronic
1050777747 9:9287949-9287971 TTCAGTGTTTGGAAAGCAGATGG - Intronic
1050966499 9:11810570-11810592 TACAGTGTTTCTGCTGAAAAAGG + Intergenic
1051815933 9:21105544-21105566 TTCTGTGTTTTTAATGAATAGGG - Intergenic
1054853943 9:69878063-69878085 TTCACTGTTAGAACTGAAGAGGG - Intronic
1055719498 9:79156018-79156040 TTCAGAGTTTGTCCTAAAGCTGG - Intergenic
1056297080 9:85204023-85204045 TTCAGAGTTTGTCTTGGAGAAGG + Intergenic
1062141536 9:134961723-134961745 TGCAGTGTTTGCAGTGAAGCTGG - Intergenic
1185549493 X:971923-971945 TTCAGTGTGTGTACTGTAAAGGG - Intergenic
1187483315 X:19678149-19678171 TTCAGTGTCATTACTGATGAAGG - Intronic
1187775209 X:22748917-22748939 TTCAGTATCTGTACTTAACAAGG + Intergenic
1187778988 X:22795788-22795810 TTCTGTGATTGGACTGATGAGGG + Intergenic
1188336961 X:28948159-28948181 TTCATTTTTTGAACTGAAGAAGG - Intronic
1190497314 X:51039339-51039361 TCCAGGGTTTATAGTGAAGATGG - Intergenic
1190779901 X:53583882-53583904 TTCAGTGTTTGTACTCTCTAGGG + Exonic
1192784052 X:74320915-74320937 TTCCTTGTCTGTCCTGAAGAGGG + Intergenic
1192804561 X:74497356-74497378 TTCTTTGTCTGTCCTGAAGAGGG - Intronic
1196193007 X:112813702-112813724 TTCAGTGATTGTATCAAAGATGG + Intronic
1197197004 X:123712461-123712483 TTCAGTGTTTTTACTAAAGCTGG - Intronic
1197433563 X:126397089-126397111 TTCAGTGTTTGTTGAGTAGAAGG + Intergenic
1197557495 X:127974629-127974651 TTCAGTGGTTGTCATGAAAATGG + Intergenic
1197636369 X:128919303-128919325 TTCAGTCTTTATTCTGAAGTTGG + Intergenic
1198063938 X:133077047-133077069 TTGAGACTTTGTAGTGAAGAAGG - Intronic
1200275766 X:154730874-154730896 TCCTGTGATTGTCCTGAAGATGG + Intronic
1202332306 Y:23767683-23767705 TTCAATGCTTGTGCAGAAGAAGG - Intergenic
1202538463 Y:25902380-25902402 TTCAATGCTTGTGCAGAAGAAGG + Intergenic