ID: 1130637887

View in Genome Browser
Species Human (GRCh38)
Location 15:85642546-85642568
Sequence CCCCGCCCCATGGCGTTAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 68}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130637873_1130637887 1 Left 1130637873 15:85642522-85642544 CCTTTAGGGATTCCCCCCACCTC 0: 1
1: 0
2: 0
3: 34
4: 198
Right 1130637887 15:85642546-85642568 CCCCGCCCCATGGCGTTAGGGGG 0: 1
1: 0
2: 1
3: 5
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130637887 Original CRISPR CCCCGCCCCATGGCGTTAGG GGG Intronic
901277823 1:8006318-8006340 CCCCGCCACATGGCAGCAGGTGG - Intronic
901674364 1:10874388-10874410 CCCCGCCCCACTGCGTTAGGAGG - Intergenic
903651912 1:24927727-24927749 CCCCGCCCCGTGTCTTCAGGTGG - Exonic
911868460 1:103059272-103059294 CCTCACCCCATGACCTTAGGTGG - Intronic
919748661 1:201023587-201023609 CGCCGCCCGATGGCGCGAGGAGG - Exonic
924282596 1:242453088-242453110 CCCAGCTCGATGGTGTTAGGAGG + Intronic
1067081041 10:43212359-43212381 CCCCGCCCCATGGAGTGAGTAGG + Intronic
1083751655 11:64764204-64764226 CCCAGGCCCAGGGCCTTAGGTGG + Intergenic
1083782357 11:64925038-64925060 CCCCACCCCATGAGGTTTGGGGG + Intronic
1084320833 11:68372629-68372651 CCCCGCTCCATGGGGTTTGGAGG + Intronic
1089096988 11:115927448-115927470 CCCCTCCCCAAGGCCTGAGGCGG - Intergenic
1089115252 11:116089686-116089708 CCACGTCCCATGGCCTTAGCAGG - Intergenic
1089787988 11:120921730-120921752 CCCCACCCCATGGAGAGAGGAGG - Intronic
1098369083 12:69738711-69738733 CCGCGCCCCCTGGCGCCAGGCGG - Intronic
1102008012 12:109601040-109601062 CCCCTCCACATGGCTTTGGGAGG + Intergenic
1106604441 13:31214494-31214516 CCCGGCCCCATTGCCTTAGTAGG + Intronic
1107146929 13:37069905-37069927 CCCCGCCCCAGGCTGTGAGGAGG + Intergenic
1113082595 13:106534687-106534709 CCCCGCCCCATTTCACTAGGTGG - Intronic
1119453468 14:74733402-74733424 ACCCGCCCCATGGGGTGAAGTGG - Intronic
1123125063 14:105940597-105940619 CCCCACCCCCTGGCATGAGGAGG + Intergenic
1126158505 15:45587259-45587281 CTCTGCCCCATGGCGTTGTGGGG - Exonic
1129871443 15:78944334-78944356 CCAGGGCCCATGGCGTCAGGTGG - Intronic
1130637887 15:85642546-85642568 CCCCGCCCCATGGCGTTAGGGGG + Intronic
1132185817 15:99800967-99800989 CACCGCCTCATGGGGGTAGGCGG - Intergenic
1132429859 15:101751731-101751753 CACCGCCTCATGGGGGTAGGCGG + Intergenic
1133536133 16:6704131-6704153 GCCTGCCCCATGGGGCTAGGAGG - Intronic
1147317967 17:39629812-39629834 CCCCACCCTGTGGCTTTAGGGGG - Intronic
1151307500 17:73272709-73272731 CTCCTCCCCATGGGGGTAGGGGG - Intergenic
1151913946 17:77103817-77103839 CCCGGCTCCATGGGGTTATGAGG + Intronic
1152779310 17:82219340-82219362 CCCCGCCCCTTGGAGATGGGTGG - Intergenic
1157689778 18:49671910-49671932 CCCCGCCCCAAGGAGGTAGATGG - Intergenic
1168110999 19:54191247-54191269 CCCCGCCCCTAGGCCTCAGGGGG - Intronic
928178843 2:29053402-29053424 CCTCACCCCAGGGCGTAAGGAGG - Exonic
932337037 2:70937467-70937489 CCCTGCCCCATGGAGCTCGGGGG + Intronic
936026160 2:109032576-109032598 CCCCTCCCCATGGGGTGGGGTGG + Intergenic
936152595 2:110029947-110029969 CCCCACCTCAGGGCGTTGGGTGG + Intergenic
936192085 2:110341465-110341487 CCCCACCTCAGGGCGTTGGGTGG - Intergenic
940224007 2:151382947-151382969 TCCCTCCCCATGGCCTTAGGTGG - Intergenic
1171252264 20:23657370-23657392 CCCTCACCCATGGCGCTAGGTGG + Intergenic
1172133646 20:32673098-32673120 ACCCGCCCCAGGGTGTGAGGTGG - Intergenic
1174092806 20:48062858-48062880 CCCCTCCCCTTGAAGTTAGGTGG - Intergenic
1175433715 20:58927650-58927672 CCCTGCCATATGGGGTTAGGTGG - Intergenic
1176376043 21:6087285-6087307 CCCAGCCCCATGAGGTCAGGAGG - Intergenic
1179747432 21:43450959-43450981 CCCAGCCCCATGAGGTCAGGAGG + Intergenic
1183486233 22:38089065-38089087 CCCCGCCCCGGGGCGGCAGGAGG - Intronic
1185224869 22:49646680-49646702 CCCAGCCACATGGCCCTAGGAGG + Intronic
952919170 3:38273185-38273207 CCCCACCCCATGGGGTTTGTGGG - Intronic
954440065 3:50516863-50516885 TCCAGCCCCAGGGCTTTAGGAGG - Intergenic
962407591 3:135113165-135113187 CCCCGCCCCATGCTGGTAGATGG + Intronic
969298983 4:6286247-6286269 CCCAGTCCCATGGTGTTAGGAGG + Intronic
969574549 4:8029441-8029463 CCTCGCCCCAAGGCATGAGGAGG + Intronic
980920894 4:139084403-139084425 CCCCTGCCCCTGCCGTTAGGTGG - Intronic
999601697 5:153273290-153273312 CCCCTCCCAATGGCATTAGATGG + Intergenic
1002455810 5:179344986-179345008 CCCCGGCCCAAGGCGCTCGGGGG + Intronic
1002914159 6:1515554-1515576 CCCCTGCCCCTGCCGTTAGGTGG - Intergenic
1006446304 6:34081675-34081697 CCCCGCCCCAGGGCACTTGGTGG + Intronic
1006472432 6:34236492-34236514 CCCCCCCCCAGGGCGTGTGGGGG - Intergenic
1017721116 6:157243857-157243879 CCCAGTGTCATGGCGTTAGGAGG + Intergenic
1018092930 6:160361133-160361155 CCTCTCCCCATGGAGTTATGAGG - Intronic
1018774320 6:166999267-166999289 CCCTGCCCCCTGGCGTCGGGAGG - Exonic
1019437146 7:1028169-1028191 CCCCGCCCCGCGGCGACAGGTGG - Intronic
1022923409 7:35037655-35037677 CCCCGCCCCCCGGCGTTCCGCGG - Intronic
1024275181 7:47671538-47671560 CCCAGCCCCGGGGGGTTAGGCGG - Intergenic
1024943117 7:54782651-54782673 CCCGGCCTCATGGCCTTTGGGGG + Intergenic
1026339110 7:69420297-69420319 CCCAGCCCCCTGCAGTTAGGTGG - Intergenic
1029191839 7:98777488-98777510 CCCTCCCCCATGGGGTTGGGGGG + Intergenic
1041084160 8:54241840-54241862 CCCCTCCCCATTGCTTTAGATGG - Intergenic
1045702416 8:104881974-104881996 CCTGGCCCCATGAAGTTAGGTGG + Intronic
1049746613 8:144265777-144265799 CTCCTCCCCATGGAGATAGGGGG + Intronic
1057137856 9:92706691-92706713 CCCTGCCCCGTGGCTTTGGGTGG + Intergenic
1057293171 9:93819982-93820004 CCATGCCCCATGGTGTTAGAAGG + Intergenic
1062037523 9:134389382-134389404 CCTGGCCCCAGGGGGTTAGGGGG + Intronic
1062174516 9:135153515-135153537 CCCCACCCCATGGAGTTAAGTGG - Intergenic
1189998430 X:46661614-46661636 CCCGGCCACATGGTGTTATGTGG - Intronic
1200076799 X:153555216-153555238 CCCCTGCCCATGGCCTCAGGGGG + Intronic