ID: 1130642022

View in Genome Browser
Species Human (GRCh38)
Location 15:85685757-85685779
Sequence GGGCACGGTGGATCACACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 0, 2: 5, 3: 38, 4: 284}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130642022_1130642028 27 Left 1130642022 15:85685757-85685779 CCTGGGTGTGATCCACCGTGCCC 0: 1
1: 0
2: 5
3: 38
4: 284
Right 1130642028 15:85685807-85685829 TATTTTTCACATGCTCATTATGG 0: 1
1: 0
2: 4
3: 29
4: 321

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130642022 Original CRISPR GGGCACGGTGGATCACACCC AGG (reversed) Intronic
901023476 1:6266964-6266986 GGGCAGGCTGGATCGCACTCAGG + Intronic
901552400 1:10005336-10005358 GGGCATGGTGGCTCACACCTGGG - Intronic
901953872 1:12770262-12770284 GGGCACGGTGGGGCAGCCCCTGG + Intergenic
902007478 1:13243764-13243786 GGGCATGGTGGTGCACACCTGGG + Intergenic
902429269 1:16350469-16350491 GGGCACGGTGGCTCAAGCCTGGG + Intronic
902958039 1:19940140-19940162 GGGCACGGTGGCTCACGCCTGGG - Intergenic
903482048 1:23660896-23660918 GGGCACCGTGGCTCACACCCAGG - Intergenic
903580144 1:24364711-24364733 GGTCAGGCTGGATCAAACCCAGG + Intronic
903669336 1:25026167-25026189 AGGCACAGTGGCTCACACCTGGG + Intergenic
904661238 1:32086843-32086865 AGGCAGGGTGGATCAGGCCCAGG + Intronic
905190876 1:36233542-36233564 GGGCACAGTGGCTCATAGCCTGG + Intronic
908125497 1:61026203-61026225 GGGCACTGTGGCTCACACTTTGG - Intronic
909702310 1:78540181-78540203 GAGCATGGTGAATCACACACAGG + Intergenic
910282751 1:85519344-85519366 AGGCACGGTGGCTCACGCCACGG - Intronic
911321692 1:96421444-96421466 GGGCACGGTGGCTCACGCCGAGG + Intergenic
912839356 1:113025394-113025416 GAGCACAGTGGCTCACGCCCAGG + Intergenic
913067335 1:115268511-115268533 GGGCACGGAGAATTACACACAGG + Intergenic
913958129 1:143321391-143321413 GGGCAGGGTGGAGCAGGCCCAGG + Intergenic
914052444 1:144146766-144146788 GGGCAGGGTGGAGCAGGCCCAGG + Intergenic
914126753 1:144819775-144819797 GGGCAGGGTGGAGCAGGCCCAGG - Intergenic
914207258 1:145543637-145543659 GGGCACGGTGGCTCACGCCACGG + Intergenic
915682288 1:157593054-157593076 GGGCAGGGAGCATCACACACTGG + Intronic
917550497 1:176022292-176022314 GGGCACTGTGGATCCTACCAGGG - Intronic
918889846 1:190252954-190252976 GGGCAGGGAACATCACACCCTGG - Intronic
922892954 1:229075615-229075637 GGGAATGGTGGAGTACACCCAGG + Intergenic
923436370 1:233971438-233971460 GGGCGCGGTGGCTCACGCACAGG + Intronic
924051648 1:240085387-240085409 GGGCACGGTGGCTCACGCCTGGG + Intronic
1064069725 10:12217809-12217831 GGGCGCGGTGGCTCACGCCTGGG + Intronic
1065899055 10:30188599-30188621 GGGCACGGTGGCTGGCTCCCCGG - Intergenic
1066759548 10:38739187-38739209 GGGCAGGGTGGAGCAGGCCCAGG - Intergenic
1067240884 10:44492124-44492146 GGGCAGGGAACATCACACCCTGG + Intergenic
1069126542 10:64642349-64642371 AGGCACGGTGGTTCACGCCTGGG - Intergenic
1069223408 10:65911324-65911346 AGGTACAGTGGATCACACACAGG - Intergenic
1071314490 10:84380973-84380995 GGGCATGGTGGCTCACGCCCTGG - Intronic
1073520578 10:104125076-104125098 GGGGATGGTGGCTCACACCTGGG - Intronic
1075699166 10:124457609-124457631 GGGCACAGTGGCTCACACCTTGG - Intergenic
1077661230 11:4070266-4070288 GGGCCAAGTGGCTCACACCCAGG - Intronic
1078951581 11:16140917-16140939 GGGCACAGTGGCTCACACTTTGG + Intronic
1080056153 11:27908784-27908806 GAGCACGGTGGAGCAGAGCCAGG - Intergenic
1080764414 11:35282167-35282189 GGGGTCTGTAGATCACACCCAGG - Intronic
1082259755 11:50069627-50069649 GGGCATGGTGGCTCATACCTGGG + Intergenic
1083768744 11:64854779-64854801 GGACACGGTGGATGACATGCTGG - Exonic
1084185775 11:67470142-67470164 GGGCACGGTGGCTCACACTTTGG + Intergenic
1084489328 11:69469861-69469883 GGGCATGGTGGCACACACCTGGG - Intergenic
1086097473 11:83065125-83065147 GGGCACAGTGGCTCACACTTTGG + Intronic
1087105174 11:94401191-94401213 GGGCTCGGTGGCTCGCACCAAGG + Exonic
1088869151 11:113876454-113876476 AGGCACGCTGTACCACACCCAGG + Intergenic
1089465430 11:118682175-118682197 GGGCATGGTGGCTCACACTTGGG - Intergenic
1092612615 12:10188207-10188229 GGGCACGGTGGCTCAGTCCAAGG + Intronic
1093085345 12:14861219-14861241 GGGCAAGGAATATCACACCCTGG - Intronic
1093621293 12:21292868-21292890 GGGCGCGGTGTCTCACACCTAGG - Intronic
1096365238 12:51023763-51023785 GGGCACGGTGGCTGGCACCCAGG + Intronic
1097247372 12:57613917-57613939 GGGGGAGGTGGAACACACCCTGG + Intronic
1097996231 12:65890862-65890884 GGGCACGGTGATGCACACCAGGG - Intronic
1098281223 12:68864734-68864756 AGTCACGGTGGCTCACACCTGGG + Intronic
1099453341 12:82835000-82835022 GGGCATGGTGGTGCACACTCAGG - Intronic
1100486132 12:95029339-95029361 GGGCACAGTGGCTCACACTTTGG - Intronic
1102011752 12:109623434-109623456 AGGCATGGTGGCTCACACCTGGG - Intergenic
1102505744 12:113383693-113383715 GGGCATGGTGGCTCACACTTTGG - Intronic
1103590485 12:121989009-121989031 GGGCACCGTGGCTCACATCTGGG - Intronic
1103721777 12:122979130-122979152 CGCCACGGTGGAGGACACCCTGG - Exonic
1104876136 12:132036125-132036147 GAGCATTGTGGAACACACCCAGG + Intronic
1105274741 13:18909198-18909220 AGGCATGGTGGCTCACACCTGGG - Intergenic
1105383647 13:19910616-19910638 GGGCACGGTGGTTCACGCCCGGG - Intergenic
1106209115 13:27624625-27624647 CGGCATGGTGGCTCACACCTGGG + Intronic
1109516981 13:63456436-63456458 GGGCATGGTGGCTCACGCCTGGG - Intergenic
1110606409 13:77437994-77438016 GGGCAGGGAAGATCACACACCGG - Intergenic
1112420657 13:99245106-99245128 GGGCAAGGTGGCTCACACAGTGG - Intronic
1112990899 13:105512848-105512870 GGGCACAGTGGCTCACGCCTGGG - Intergenic
1115250345 14:31339187-31339209 GGGCATGATGGCTCACACCAAGG + Intronic
1118211596 14:63770789-63770811 GGGCACAGTGGCTCACACAGTGG - Intergenic
1118400967 14:65379388-65379410 GGGCATGGTGGTGCACACCGTGG + Intergenic
1121281903 14:92705078-92705100 AGCCACGCTGGATCACACCAGGG + Intronic
1202930282 14_KI270725v1_random:28774-28796 GGGCAGGGTGGAGCAGGCCCAGG - Intergenic
1123422101 15:20142743-20142765 GGGCAGGGTGGAGCAGGCCCAGG + Intergenic
1123442980 15:20303891-20303913 GGGCAGGGTGGAGCAGGCCCAGG - Intergenic
1123531329 15:21149283-21149305 GGGCAGGGTGGAGCAGGCCCAGG + Intergenic
1125859897 15:42988555-42988577 GGGCACGGTGGATTATGCCTGGG - Intronic
1126181096 15:45785669-45785691 GGGCACGGTGGCTCACAACATGG - Intergenic
1126588146 15:50310834-50310856 GGGCATGGGGGCTCACACCTAGG + Intronic
1127784620 15:62344897-62344919 GGGCAGGTTGGATCAGGCCCTGG - Intergenic
1129363759 15:75041832-75041854 GGGCAGGGTGGATGACACAGCGG - Intronic
1130090649 15:80818277-80818299 GAGCATGGTGGATCATACACTGG + Intronic
1130208670 15:81902383-81902405 GGGCATGGTGATTCACACACTGG - Intergenic
1130642022 15:85685757-85685779 GGGCACGGTGGATCACACCCAGG - Intronic
1132114987 15:99129498-99129520 GGGCACCGTGGATCTCAGACGGG + Exonic
1132403353 15:101527425-101527447 GGGCATGGTGGCTCACACCTTGG - Intergenic
1132692783 16:1189021-1189043 GGCCATGGTGGCTCACACCAAGG - Intronic
1132762588 16:1517976-1517998 AGGCATGGTGGCTCACACCTGGG - Intronic
1134057515 16:11179972-11179994 GGGGAGGGTGGATCACGGCCTGG - Exonic
1134280643 16:12813876-12813898 GGGCATGGTGGTTCACATCTGGG + Intergenic
1134385884 16:13771971-13771993 GGGCAGGGAACATCACACCCCGG - Intergenic
1135562994 16:23490935-23490957 GGGCATGGTGGCTCACGCCTGGG + Intronic
1136718268 16:32301791-32301813 GGGCAGGGTGGAGCAGGCCCAGG + Intergenic
1136773698 16:32860355-32860377 GGGCAGGGTGGAGCAGGCCCAGG - Intergenic
1136836642 16:33508061-33508083 GGGCAGGGTGGAGCAGGCCCAGG + Intergenic
1136896914 16:34001164-34001186 GGGCAGGGTGGAGCAGGCCCAGG + Intergenic
1136910745 16:34142445-34142467 AGGCACAGTGGCTCACACCGGGG + Intergenic
1138024492 16:53511976-53511998 GGGCACGGTTGCTCAAACCAGGG - Intergenic
1138107586 16:54297489-54297511 GGGCACGGTGTACCACAGACTGG + Intergenic
1138122852 16:54414407-54414429 AGGCGCGGTGGCTCACACACAGG - Intergenic
1138415426 16:56868685-56868707 GGGCACGGTGGCTCACGCTTTGG + Intronic
1138479941 16:57295851-57295873 AGGCAAGGTGGCTCACACCTGGG - Intergenic
1138590685 16:57998130-57998152 GGGCACGGCGGAGAACCCCCTGG - Exonic
1139804163 16:69549977-69549999 AGGCACCGTGGCTCACACCACGG + Intergenic
1140104829 16:71950218-71950240 AGGCACGCTGGGTCTCACCCAGG - Exonic
1140148527 16:72337086-72337108 GGGCGCGGTGGCTCACGCCTGGG + Intergenic
1140349507 16:74248676-74248698 GGGCATGGTGGCTCACACAGTGG + Intergenic
1142220020 16:88849697-88849719 GGGCGTGGTGGCTCACACCTGGG - Intronic
1203008160 16_KI270728v1_random:215974-215996 GGGCAGGGTGGAGCAGGCCCAGG - Intergenic
1203076116 16_KI270728v1_random:1122466-1122488 GGGCAGGGTGGAGCAGGCCCAGG - Intergenic
1203146827 16_KI270728v1_random:1808362-1808384 GGGCAGGGTGGAGCAGGCCCAGG + Intergenic
1142668018 17:1473491-1473513 GGGCACAGTGAGCCACACCCTGG + Intronic
1142818134 17:2444188-2444210 GGGCACGGTGGCTCACACTTTGG + Intronic
1143113615 17:4568157-4568179 GGGTACAGTGGCTCAAACCCAGG - Intergenic
1143468116 17:7151988-7152010 AGGCACGGTGGCTCATACCTGGG + Intergenic
1143810894 17:9471126-9471148 GGGTGCGGTGGCTCACGCCCCGG - Intronic
1146565804 17:33911842-33911864 GGGCACGGTGGTTCACAGGCCGG + Intronic
1146835090 17:36104492-36104514 GGGCAGTGTTGATCTCACCCTGG + Intronic
1146849705 17:36211740-36211762 GGGCAGTGTTGATCTCACCCTGG + Intronic
1147005880 17:37403651-37403673 GGACACGGTGCCTCACACCTGGG - Intronic
1148168034 17:45497434-45497456 GGGCACGGTGGCTCACACTTTGG + Intergenic
1148280783 17:46345523-46345545 GGGCATGGTGGCTCACACTTTGG - Intronic
1148303011 17:46563458-46563480 GGGCATGGTGGCTCACACTTTGG - Intronic
1150399218 17:64843850-64843872 GGGCACGGTGGCTCACACTTTGG + Intergenic
1150496035 17:65608432-65608454 GGGCACAGTGCCTCTCACCCTGG - Intronic
1151223468 17:72631285-72631307 GGCCACCGTGGAGCACAACCAGG + Intergenic
1152930634 17:83107861-83107883 GGGCACGGAGTGTCACACACAGG + Intergenic
1153207826 18:2722181-2722203 GGGCATGGTGGCTCACGCCTGGG + Intronic
1153434608 18:5056154-5056176 TGGCAGGGTGGTTCACACTCTGG + Intergenic
1153479355 18:5531445-5531467 GGGCACAGTGGTTCACACCTGGG + Intronic
1156645762 18:39160560-39160582 GAGCACAGTGGCTCACACCTGGG - Intergenic
1156905964 18:42352316-42352338 GGGCAGGGAACATCACACCCTGG - Intergenic
1157718172 18:49903592-49903614 GGTCAGGGTGGAGCACACCCTGG - Intronic
1157802622 18:50633323-50633345 GGGCACAGTGGCTCACTCCCAGG - Intronic
1158690768 18:59658226-59658248 GGGCACAGTGGCTCACACTTTGG + Intronic
1160322927 18:77913642-77913664 GGGCATGGTGGTGCACACCTGGG - Intergenic
1160542058 18:79629250-79629272 TGGCACGGGGGACCACACCCGGG + Intergenic
1160546642 18:79661317-79661339 GGGCATGGTGGTGCACACCTGGG + Intergenic
1161071221 19:2262278-2262300 GGGCACAGTGGCTCACACCTGGG + Intronic
1161160932 19:2761565-2761587 GGCCACGGTGAATAACCCCCTGG + Intronic
1161360011 19:3843193-3843215 GGGCGCGGTGGCTCACGCCTGGG + Intronic
1161626461 19:5329799-5329821 GGGCATGGTGGCTCACGCCTGGG + Intronic
1161730816 19:5959478-5959500 GTACACGGTGAATCAGACCCTGG - Intronic
1161983092 19:7640706-7640728 GGGGAAGGTGGATCACTCTCTGG - Exonic
1163734133 19:18968403-18968425 GGGCACAGTGGCTCACACTTTGG - Intergenic
1164879578 19:31720802-31720824 GGGCAGGGTGGGTCCCAGCCAGG - Intergenic
1165559545 19:36667265-36667287 GGGCGCGGTGGCTCACGCCAAGG + Intergenic
1165791690 19:38496537-38496559 GGGCTCGGGGGTTCTCACCCAGG - Exonic
1167495621 19:49816828-49816850 GGGCACGATGGCTAACACCTGGG + Intronic
1167593231 19:50415447-50415469 GGGCGCGGTGGCTCACGCACAGG + Exonic
1167687151 19:50963455-50963477 AGTCAGGGTGGATCACAGCCCGG + Exonic
1168026740 19:53648550-53648572 GGGCACGGTGGTTCCCATCAGGG + Intergenic
1168026769 19:53648644-53648666 GGGCACGGTGGTTCCCATCAGGG + Intergenic
1168026784 19:53648691-53648713 GGGCACGGTGGTTCCCATCAGGG + Intergenic
1168026810 19:53648785-53648807 GGGCACGGTGGTTCCCATCAGGG + Intergenic
1168026839 19:53648879-53648901 GGGCACGGTGGTTCCCATCAGGG + Intergenic
1168026854 19:53648926-53648948 GGGCACGGTGGTTCCCATCAGGG + Intergenic
1168026880 19:53649020-53649042 GGGCACGGTGGTTCCCATCAGGG + Intergenic
1168598189 19:57695932-57695954 CGGCGCGGTGGCTCACACCAGGG - Intronic
1202691842 1_KI270712v1_random:99190-99212 GGGCAGGGTGGAGCAGGCCCAGG + Intergenic
925672639 2:6327659-6327681 GGGCAGGGAGCATCACACACTGG - Intergenic
927865881 2:26587011-26587033 CGGCACGGTGGATTACACTGTGG + Intronic
927899163 2:26806488-26806510 GGGCTCGGAGGGCCACACCCAGG + Intergenic
929343114 2:40847268-40847290 GGGCATGGTGGCTCACACTTGGG + Intergenic
930032900 2:47069266-47069288 GGGCCCGATGGGTCACATCCTGG - Intronic
931307124 2:61040554-61040576 GGGCAGGGAGCATCACACACTGG + Intronic
932235141 2:70114961-70114983 GGGCATGGTGGTACACACCTAGG - Intergenic
933891274 2:86772851-86772873 AGGCAAGGTGGCTCACACCTGGG - Intronic
933954548 2:87354766-87354788 GGGCAGGGTGGAGCAGGCCCAGG - Intergenic
934238745 2:90250986-90251008 GGGCAGGGTGGAGCAGGCCCAGG - Intergenic
934274452 2:91565724-91565746 GGGCAGGGTGGAGCAGGCCCAGG + Intergenic
934322868 2:91983536-91983558 GGGCAGGGTGGAACAGGCCCAGG - Intergenic
934461169 2:94214317-94214339 GGGCAGGGTGGAGCAGGCCCAGG - Intergenic
936805881 2:116331968-116331990 GGGCAGGGAGCATCACACACTGG - Intergenic
937721525 2:125102328-125102350 GGGCAGGGAACATCACACCCCGG + Intergenic
938016642 2:127872803-127872825 GGGCACCCTGGATCTCACTCAGG + Intronic
938417981 2:131120348-131120370 GGGCACGGTGGCTCAGGCCGAGG - Intronic
939755292 2:146102261-146102283 TGGCAGGTTAGATCACACCCAGG - Intergenic
940846767 2:158650748-158650770 GGGCACGGGGGAGCTCACTCAGG - Intronic
942015418 2:171808877-171808899 GGGCAGGGAGCATCACACACTGG - Intronic
944164549 2:196704723-196704745 GGGCAGGGAACATCACACCCCGG - Intronic
944249050 2:197562680-197562702 GGGCAGGGAACATCACACCCCGG - Intergenic
945492590 2:210474267-210474289 GAACACGGAGGATCAAACCCTGG - Intronic
946320329 2:218950273-218950295 AGGCACTGTGGACCACAACCCGG - Intergenic
947186536 2:227460239-227460261 AGGCACCGTGGACCACAGCCAGG - Intergenic
947688840 2:232115887-232115909 TGGCGCGGTGGCTCACACACAGG + Intronic
948101271 2:235375008-235375030 GGGCGTGGTGGCTCACGCCCAGG + Intergenic
948461638 2:238132583-238132605 GTGCACTGTGGGTGACACCCAGG - Exonic
948606313 2:239137784-239137806 TTGCATGTTGGATCACACCCAGG - Intronic
1171998843 20:31755502-31755524 GGGCGCGGTGGCTCACACTTGGG + Intronic
1172537266 20:35683830-35683852 GGGTATGGTGGCTCACACCTGGG + Intronic
1173144273 20:40511352-40511374 GGACAGGGAGGCTCACACCCTGG - Intergenic
1173199920 20:40946852-40946874 GGGCACGGCTGAGCACATCCCGG + Intergenic
1173293064 20:41731268-41731290 GGGCAGGGAAGATCACACCCTGG - Intergenic
1173739158 20:45384444-45384466 GGGCATGGTGGCTCACACGATGG - Intronic
1174005495 20:47407652-47407674 GGGCGCAGTGGCTCACACCGCGG + Intergenic
1175964521 20:62653858-62653880 GGGCAGGGAACATCACACCCCGG + Intronic
1176051853 20:63124138-63124160 GGGCACGGTGGCTCACACCTGGG - Intergenic
1176592294 21:8657356-8657378 GGGCAGGGTGGAGCAGGCCCAGG - Intergenic
1176866373 21:14057011-14057033 GGGCAGGGTGGAGCAGGCCCAGG + Intergenic
1177948824 21:27507897-27507919 AGGCACGGTGGCTCACACTTTGG - Intergenic
1177949945 21:27522462-27522484 GGGCAGGGAGCATCACACACTGG + Intergenic
1179788903 21:43744228-43744250 GGGGAGGGAGGGTCACACCCAGG + Intronic
1180054415 21:45349846-45349868 GGGCACGGTGGGCCCCACTCTGG + Intergenic
1180275145 22:10634485-10634507 GGGCAGGGTGGAGCAGGCCCAGG - Intergenic
1180549618 22:16529419-16529441 GGGCAGGGTGGAGCAGGCCCAGG - Intergenic
1180916346 22:19490966-19490988 GGGCATGGTGGCACACACCTGGG - Intronic
1182656492 22:31894582-31894604 GGGCACGGAGGTTCACGCCTTGG + Intronic
1183893456 22:40949857-40949879 GGGCGCGGTGGCTCACGCCTGGG - Intergenic
1184508981 22:44921112-44921134 GGGCAGGTTGGTGCACACCCAGG - Intronic
1184830163 22:46980456-46980478 GGGCACAGTGGCTCACACCTGGG - Intronic
1185324990 22:50221197-50221219 GGCCACGGTGGAACACCCACGGG - Exonic
950000534 3:9652728-9652750 AGGCATGGTGGCTCACACCTGGG + Intronic
951468561 3:23030589-23030611 GGGCAGGGTACATCACACACCGG - Intergenic
954259409 3:49427969-49427991 GGGCACGGTGGCTCATGCCGTGG + Intronic
954363230 3:50133361-50133383 GGACACTGGGGATCAGACCCTGG + Intergenic
957696090 3:83639523-83639545 GGGCAGGGATCATCACACCCTGG + Intergenic
957980774 3:87507905-87507927 GGGCACAGTGGCTCACATCTGGG + Intergenic
959292555 3:104493249-104493271 GGGTGCGGTGGCTCACAGCCTGG + Intergenic
960135325 3:114098486-114098508 GGGCACAGTGGCTCATAGCCAGG + Intergenic
961008583 3:123421511-123421533 GGTCATAGTGGACCACACCCAGG - Intronic
962559783 3:136593239-136593261 GGGCAGGGTGGGTCCCAGCCTGG - Intronic
962824439 3:139087830-139087852 GGGCGCTGTGGCTCACACCTTGG + Intronic
962847747 3:139286421-139286443 GGGAACTGTGGATCTCACTCAGG + Intronic
963202780 3:142601652-142601674 GGGCACGTTGGTCCACACCTGGG - Intronic
967198764 3:187052470-187052492 GGGCAGGGAACATCACACCCTGG - Intronic
968047974 3:195634821-195634843 GGGCGCGGTAGCTCACACCTGGG - Intergenic
968053899 3:195676192-195676214 GGGCATGGTGGCTCACACTTGGG + Intergenic
968099423 3:195954798-195954820 GGGCGCGGTAGCTCACACCTGGG + Intergenic
968101992 3:195972961-195972983 GGGCATGGTGGCTCACACTTGGG - Intergenic
968164363 3:196452607-196452629 AGGCACGGTGGCTCACGCCTGGG + Intergenic
968306637 3:197655100-197655122 GGGCGCGGTAGCTCACACCTGGG + Intergenic
969662396 4:8537924-8537946 GGTCATTGTGGATCAGACCCCGG + Intergenic
972072425 4:35038414-35038436 GGGCAGAGTGGATCACTCCCCGG - Intergenic
973137015 4:46721679-46721701 GGGCAGGGAAGATCACACACCGG - Intergenic
974057476 4:56998493-56998515 GGGCACGGTGGCTCACAGGCCGG - Intronic
975883637 4:78939506-78939528 GCGCACGCTCGAGCACACCCGGG - Intergenic
976020295 4:80615675-80615697 GGGCATGGTGGTTCACACCTGGG - Intronic
976420995 4:84843680-84843702 GGGCACAGTAGCTCACACCCAGG - Intronic
976760588 4:88544869-88544891 GGGCAGGGAGCATCACACACTGG + Intronic
978402052 4:108341527-108341549 GGGCTCGGTGCACCACACCCAGG - Intergenic
978791986 4:112672299-112672321 GGGCACGGTGGCTCATGCCTGGG + Intergenic
980696517 4:136363497-136363519 GGGCAGGGAGCATCACACACTGG + Intergenic
981319092 4:143370721-143370743 GGGCAGGGAACATCACACCCCGG - Intronic
983219559 4:165031561-165031583 GGGCGCGGTGGCTCACAGCGAGG + Intergenic
986490688 5:8286644-8286666 GGGCAGGGAACATCACACCCTGG + Intergenic
998181814 5:139951397-139951419 GGACATAGTGGATCACAGCCAGG + Intronic
999155701 5:149456068-149456090 GGGAACGCTGACTCACACCCAGG - Intergenic
999615572 5:153419263-153419285 GGGCAGGGAGCATCACACACTGG - Intergenic
999799146 5:155017246-155017268 GGGCACTGTTGAACAGACCCAGG + Exonic
1001076933 5:168636838-168636860 GGGCAGGGAACATCACACCCCGG + Intergenic
1001160770 5:169310809-169310831 GGGCAGGGAACATCACACCCTGG - Intergenic
1002603697 5:180369958-180369980 GGGCACGGTGGCTCAAGGCCTGG - Intergenic
1005831997 6:29678799-29678821 GGGCGCGGTGGATCACTTCAGGG + Intronic
1006730793 6:36234854-36234876 GGGCACAGTGGAGCCCACCTAGG + Intergenic
1006844730 6:37054367-37054389 GGGCGCGGTGGCTCACGCCCGGG - Intergenic
1007522883 6:42465984-42466006 GGGCATGGTGGCTCACGCCTGGG - Intergenic
1007549997 6:42721944-42721966 GGGCTCGCTGGAGAACACCCTGG - Exonic
1007859950 6:44898323-44898345 AGGCACTGTGGTTCACACCTTGG + Intronic
1008512390 6:52288640-52288662 GGGCATGGTGGCTCACGCCAAGG - Intergenic
1009756147 6:67942716-67942738 GGGCAGGGAACATCACACCCTGG + Intergenic
1011436118 6:87339052-87339074 GGCCACAGTGGCTCACACCAAGG + Intronic
1011544791 6:88471342-88471364 GGGCAGGGAACATCACACCCTGG + Intergenic
1013523769 6:110956055-110956077 GGGCGCGGTGGCTCACACTTTGG + Intergenic
1014232950 6:118924782-118924804 GGGCACCGTGGCTCACACTTGGG + Intronic
1014440776 6:121471470-121471492 GGGCATGGTGGCTCACACTTTGG + Intergenic
1017089805 6:150749304-150749326 GTCCACGCTGGATCTCACCCTGG - Intronic
1018616980 6:165695915-165695937 GGGCACTGTTGAAAACACCCAGG + Intronic
1019105649 6:169664911-169664933 GGGCACGGGGGATGCCACACAGG + Intronic
1019105668 6:169664973-169664995 GGGCACGGGGGATGCCACACAGG + Intronic
1019105687 6:169665035-169665057 GGGCACGGGGGATGCCACACAGG + Intronic
1019105706 6:169665097-169665119 GGGCACGGGGGATGCCACACAGG + Intronic
1019948168 7:4346858-4346880 AGGCACGGAGGATCACAGACAGG - Intergenic
1020223237 7:6258025-6258047 GGGCACGGTGGCTCACTCCTGGG + Intronic
1021804830 7:24344490-24344512 GGGCACGGTGGCTCATGCCACGG + Intergenic
1022665240 7:32404609-32404631 GGGCACAGTGGCTCACACTGAGG - Intergenic
1023850780 7:44149092-44149114 GGGCTGGGGGGATCACAGCCAGG + Intronic
1023974575 7:45018619-45018641 GGGCATGGTGGCTCACGCCTTGG - Intronic
1025086856 7:56030397-56030419 GGGCATGGTGGCTCACACCTTGG - Intronic
1025874825 7:65471211-65471233 GGGCATGGTGGCTCACACCAAGG + Intergenic
1026149476 7:67775769-67775791 GGGCACGGTGGCTCACACCTTGG - Intergenic
1026856735 7:73759995-73760017 GGGCGTGGTGGCTCACAGCCAGG - Intergenic
1029246426 7:99205284-99205306 GGGCATGGTGGTACACACCATGG + Intronic
1029545124 7:101206526-101206548 GGGCACGGTGCAGCAGACCGGGG + Intronic
1030934251 7:115564944-115564966 GGGAAAGGTGCACCACACCCAGG - Intergenic
1031611477 7:123832758-123832780 GGGCGCGGTGGCTCACGCCTGGG - Intronic
1032335242 7:131018706-131018728 AGGCAGGGGGAATCACACCCTGG - Intergenic
1033342215 7:140500932-140500954 GGGCGCGGTGGCTCACACGCTGG - Intergenic
1034252229 7:149701677-149701699 GGGCACTGAGGAGCACACCACGG - Intergenic
1035974488 8:4292530-4292552 GGGCACGGTGGCTCACGCCTGGG - Intronic
1038116854 8:24566040-24566062 GGGCAGGGAACATCACACCCTGG - Intergenic
1039049388 8:33479128-33479150 GGGCACGGTGGCTTACGCCTGGG + Intronic
1041073231 8:54145453-54145475 CGGCATGGTGGCTCACACCAAGG - Intronic
1045303564 8:100936538-100936560 GGGCACGGTGGCTCACTCCTTGG + Intronic
1045478257 8:102571808-102571830 GGGTATGGTGGAACATACCCCGG + Intergenic
1048342009 8:133547489-133547511 GGGCATGGTGGCTCATGCCCAGG - Intronic
1048975890 8:139672862-139672884 GGGCAGGGTGGAACCCACGCAGG - Intronic
1049395831 8:142400062-142400084 GGGCACGGTGGCTCACACCTGGG + Intronic
1051626591 9:19104564-19104586 GGGCACGGTGGCTCATTCCTTGG - Intergenic
1053069714 9:35093965-35093987 GGCCACAGTGGTCCACACCCAGG + Exonic
1053318685 9:37075931-37075953 GGGCACTGTGGTTCACACTGAGG + Intergenic
1054273137 9:63047491-63047513 GGGCAGGGTGGAGCAGGCCCAGG + Intergenic
1054302921 9:63390960-63390982 GGGCAGGGTGGAGCAGGCCCAGG - Intergenic
1054401702 9:64717476-64717498 GGGCAGGGTGGAGCAGGCCCAGG - Intergenic
1054435305 9:65201785-65201807 GGGCAGGGTGGAGCAGGCCCAGG - Intergenic
1054495085 9:65819896-65819918 GGGCAGGGTGGAGCAGGCCCAGG + Intergenic
1060510843 9:124230878-124230900 GGGCGCGGTGGCTCATACCACGG + Intergenic
1060974730 9:127758101-127758123 GGGTGCGGTGGCTCACACCTGGG - Intronic
1061123557 9:128659234-128659256 GGGCGCGGTGGCTCACAACTGGG + Intergenic
1061788278 9:133043981-133044003 GGGCACGGAGGCTCACACACTGG + Intronic
1062095813 9:134702617-134702639 GGGCACGGTTGAACTGACCCTGG + Intronic
1062154396 9:135038526-135038548 GGGCTGGGAGGATCCCACCCAGG + Intergenic
1203622348 Un_KI270749v1:136203-136225 GGGCAGGGTGGAGCAGGCCCAGG - Intergenic
1185706952 X:2274704-2274726 GGGCGCGGTGGCTCACACCTGGG - Intronic
1187328848 X:18317178-18317200 GGGCATGGTGGCTCACACTTTGG - Intronic
1190258804 X:48785409-48785431 AGGCAGACTGGATCACACCCTGG - Intergenic
1190378646 X:49816223-49816245 GGGCACGGTGGCTCACGCTCTGG + Intergenic
1191200676 X:57777993-57778015 GGGCACGGAACATCACACACTGG - Intergenic
1192199277 X:69054857-69054879 GGGCAGGGAATATCACACCCCGG + Intergenic
1194300822 X:92183514-92183536 AGGCACGGTGGCTCACGCCTGGG - Intronic
1195735466 X:108008278-108008300 GGGCACTGTGGCTCACTCCCAGG - Intergenic
1198587834 X:138142356-138142378 GGGCAGGGAACATCACACCCCGG - Intergenic
1198659600 X:138953396-138953418 GGGCAGGGAACATCACACCCCGG + Intronic
1198725283 X:139670485-139670507 GGGCAGGGAACATCACACCCCGG - Intronic
1201190360 Y:11438703-11438725 GGGCAGGGTGGAGCAGGCCCAGG - Intergenic
1202052515 Y:20795975-20795997 TGGTACTGTGGATCACACACTGG + Intergenic
1202583260 Y:26403201-26403223 GGGCAGGGTGGAGCAGGCCCAGG + Intergenic