ID: 1130645748

View in Genome Browser
Species Human (GRCh38)
Location 15:85725201-85725223
Sequence ACACCAACTCCTATCTCTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 83}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130645748 Original CRISPR ACACCAACTCCTATCTCTAC AGG (reversed) Intronic