ID: 1130646695

View in Genome Browser
Species Human (GRCh38)
Location 15:85734431-85734453
Sequence AGGGCCAGGTGGAATAAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 301}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130646695 Original CRISPR AGGGCCAGGTGGAATAAGGG AGG (reversed) Intronic
900149210 1:1170934-1170956 AGGGCCAGGCAGAATGGGGGAGG - Intergenic
900310654 1:2031786-2031808 AGTGCCCTGTGGAATCAGGGTGG + Intergenic
901953010 1:12763413-12763435 AGGGCCAGGGAGAATCAGGTAGG + Exonic
902019174 1:13329818-13329840 AGGGTTAGATGGATTAAGGGCGG + Intergenic
903013484 1:20346855-20346877 GGGGACAGGTGGAATTAGGAAGG - Intronic
904058858 1:27690716-27690738 GGGGCTAGATGAAATAAGGGTGG - Intergenic
905451441 1:38059394-38059416 AGGGCCTGGAGGAATGGGGGTGG + Intergenic
907391549 1:54161468-54161490 AGGGCCAGGAGGCAGCAGGGTGG + Intronic
910209080 1:84775450-84775472 AGAGCCAGGTGGGAGCAGGGTGG - Intergenic
914416771 1:147491305-147491327 AGGGTGAGGAGGACTAAGGGGGG - Intergenic
915304199 1:154968666-154968688 AGGGCCAGGAGGCAAAAGTGTGG - Intronic
915924019 1:160002538-160002560 AGGGTGAGGGGGAAGAAGGGAGG - Intergenic
915951917 1:160195306-160195328 AGGGGAAGGTGGAATACTGGAGG - Intronic
916060454 1:161094901-161094923 ATGGAGAGGTGGAATAAGGATGG - Intergenic
919940311 1:202281746-202281768 AGGGCAAGGTGGAGCAAGTGGGG - Intronic
920554407 1:206894147-206894169 AAGGCCAGGTGGAAACAGTGGGG - Intergenic
920859434 1:209693373-209693395 AGGGCCAGGAAGAAGAAGGTGGG - Intronic
921079448 1:211726784-211726806 AGGACCACATGGAATGAGGGGGG + Intergenic
921139933 1:212298071-212298093 AGGGTTAGATGGATTAAGGGCGG - Intronic
922652586 1:227354113-227354135 AGCACCAGGTGGATTAAGGTAGG - Intergenic
924072561 1:240297033-240297055 AGGGCCATATGGAAGAAAGGAGG + Intronic
924379535 1:243449648-243449670 AGGGCCATGTGGAAAAACTGGGG - Intronic
924946561 1:248850637-248850659 AGGGCCAGGGGCTAGAAGGGAGG - Intronic
1062833901 10:623745-623767 AGGGCCAAGGGGAAGAGGGGAGG + Intronic
1063997639 10:11635628-11635650 AGGACCTCGTGGAATAAGTGTGG + Intergenic
1064129387 10:12695466-12695488 AGGGCCAGGGAGGAGAAGGGAGG - Intronic
1064262232 10:13795186-13795208 AGGGGCAGGTGGTATCAGGCAGG - Intronic
1066085903 10:31971356-31971378 AGGGTTAGATGGATTAAGGGCGG + Intergenic
1067048809 10:43000471-43000493 AGGGGCAAGTGGAAGAAGGACGG + Intergenic
1069718948 10:70538081-70538103 AGGGCCCGGTGGAAAGAGGTGGG - Intronic
1069733395 10:70634206-70634228 AGGGCCAGGTGGCAGACGGCTGG - Intergenic
1070138275 10:73715270-73715292 AGGGTTAAGTGGATTAAGGGCGG - Intergenic
1071396672 10:85230629-85230651 AGGGCCAGGGGGAATTAGGGAGG + Intergenic
1072549770 10:96468732-96468754 AGGGCCAGGTGGGGCAAGGGTGG - Intronic
1072723087 10:97792699-97792721 ATGGCCAGGTGGAATTGAGGTGG + Intergenic
1073083133 10:100872322-100872344 AGGTCCAGGAGCTATAAGGGAGG + Intergenic
1073862702 10:107765807-107765829 TGGAGCAGGTGGAATAAGTGGGG + Intergenic
1075336662 10:121613619-121613641 AGGGCCAGGGAGCATCAGGGAGG - Intergenic
1075920688 10:126210486-126210508 AGAGCAAGGTGGAACAAGTGGGG + Intronic
1077368603 11:2171307-2171329 AGGGGCAGGTGGGAGTAGGGTGG + Intronic
1077509343 11:2948079-2948101 GGGTACAGGTGGAATAAGAGTGG + Intronic
1079328633 11:19515771-19515793 TGGACCAGGTGGAAGCAGGGTGG + Intronic
1080032030 11:27671793-27671815 TGGGGTAGGTGGAATGAGGGTGG - Intronic
1080036840 11:27719733-27719755 GGGGCGGGGTGGAAGAAGGGGGG + Intronic
1081570133 11:44285781-44285803 AGGTCCTGGAGGAAGAAGGGTGG - Intronic
1081906350 11:46672785-46672807 AGTGCCAGGAGGAAGAAGGAAGG + Intronic
1082863709 11:57879020-57879042 AGGGGCTGGGGGAAGAAGGGAGG + Intergenic
1083938706 11:65883610-65883632 GGGGCCAGGTGGGTTCAGGGAGG - Exonic
1088882689 11:113984071-113984093 AGGGCCAGGTAGCATAGGAGAGG - Intronic
1088890362 11:114039330-114039352 AGGGCCAGGTGGGGTGAGGGAGG - Intergenic
1089618022 11:119706117-119706139 AGGGGAAGGTGGAAGAAGAGAGG - Intronic
1090087156 11:123660492-123660514 AGGGCCAGGTGGTAGACAGGAGG + Intergenic
1090198503 11:124837872-124837894 AGGGGCAGGTGAAAAAAGGAAGG - Intergenic
1090521715 11:127486743-127486765 AGGGCCAGGAGGAAGACGTGAGG + Intergenic
1090985998 11:131766641-131766663 AAGGACAGGTGGAATAATGGAGG - Intronic
1091744621 12:2983000-2983022 GGGGTCAGGTGGGGTAAGGGAGG + Intronic
1091778443 12:3199601-3199623 AGGGACAGGTGGACGAAGCGGGG - Intronic
1093698310 12:22188734-22188756 TGGGCCAGGGGGAAGAAGAGAGG + Intronic
1095141021 12:38662118-38662140 AGTGCCATGTTGAATAAGGGTGG - Intronic
1095980618 12:47972426-47972448 GGGGGCAGGAGGAATATGGGTGG + Intergenic
1096186344 12:49584025-49584047 AGAGCCAGGTGTCATAAGGTGGG - Intronic
1096232120 12:49902593-49902615 AGGGCCTGGTGGAGGCAGGGTGG + Intronic
1096802351 12:54119440-54119462 AGGGCAAGAAGGAATATGGGGGG + Intergenic
1096870655 12:54590144-54590166 AGGGCCAGGTGGAAAACAGCTGG + Intergenic
1096951451 12:55478715-55478737 AGGGTCAAATGGATTAAGGGTGG - Intergenic
1097055681 12:56247803-56247825 AGGGCCAGGAGGAAGAAGGGAGG + Intronic
1100196623 12:92253613-92253635 AGGGCTAAGTGAAAGAAGGGAGG + Intergenic
1101840118 12:108322028-108322050 AGGGGAAGGTAGAAGAAGGGAGG + Intronic
1102455081 12:113065979-113066001 AGAGCCAGGTGGAAGGATGGAGG - Intronic
1103366530 12:120388125-120388147 AGGGGCGGGGGGAATAAGGAAGG + Intergenic
1104052898 12:125208447-125208469 AGGGCCTGGAGGAATGGGGGTGG - Intronic
1104218550 12:126759364-126759386 TGGGCCAGGAGGAAGAAGGAAGG - Intergenic
1104676012 12:130713040-130713062 AGGGAGAGGAGGAATGAGGGAGG + Intronic
1105255215 13:18739741-18739763 AGGGCCAAGGGGAACCAGGGGGG - Intergenic
1105822583 13:24093108-24093130 AGGGTCAGGTGGAAAATGGATGG - Intronic
1107458021 13:40573015-40573037 AGGGCCAGGAGGAGTCATGGAGG - Intronic
1107840629 13:44452979-44453001 AGAGCCAGGTGAAACATGGGAGG - Intronic
1114958490 14:27852438-27852460 AGGACCAGATGGAATTATGGTGG + Intergenic
1115498308 14:34027496-34027518 AGGGGGAGGGGGAAGAAGGGAGG + Intronic
1117840563 14:59856512-59856534 GGGACCAGCTGGAATGAGGGAGG - Intronic
1118497751 14:66325549-66325571 ACGGCCAGGTGGATTCAGGGTGG - Intergenic
1119439147 14:74616618-74616640 TGGGCCAAGAGGATTAAGGGTGG - Intergenic
1122208523 14:100160146-100160168 AGGGCCGGGTGGAGGAAGGGAGG - Exonic
1122504328 14:102222147-102222169 AGGGCCAGCAGGAAGAATGGTGG - Intronic
1123122875 14:105926285-105926307 AGGGCCAGGTGGGCAATGGGAGG - Intronic
1123405518 15:20017705-20017727 AGGGCCAGGTGGGCAATGGGAGG - Intergenic
1123514850 15:21024353-21024375 AGGGCCAGGTGGGCAATGGGAGG - Intergenic
1124160948 15:27269313-27269335 AGGTCCAGGGGGCCTAAGGGAGG - Intronic
1127192102 15:56541165-56541187 AGGGTTAAATGGAATAAGGGCGG + Intergenic
1127599559 15:60521870-60521892 AAAGCTAGGTGAAATAAGGGAGG - Intronic
1128061156 15:64736799-64736821 AGGGAAAGGTGGAAAATGGGAGG - Intergenic
1129460609 15:75698411-75698433 AGGGCCAGGTGACCTCAGGGAGG - Intronic
1129724252 15:77893624-77893646 AGGGCCAGGTGACCTCAGGGAGG + Intergenic
1130567459 15:85008761-85008783 GGGGCAAGGTGGAATAGGGTGGG - Intronic
1130646695 15:85734431-85734453 AGGGCCAGGTGGAATAAGGGAGG - Intronic
1131153535 15:90061642-90061664 AGGGTCGGGTGGGATCAGGGTGG - Intronic
1131774689 15:95781990-95782012 AGGGGCAGGTGGAATAATGTGGG - Intergenic
1132829182 16:1919158-1919180 AGTGCCAGGTGGACCAAGGCTGG - Intergenic
1133023480 16:2977071-2977093 AGGGCCAGGTGGTATCAGAGTGG - Intronic
1137351732 16:47719216-47719238 AGGGCCATGTGGAGTGAGGGAGG - Intergenic
1137374201 16:47938382-47938404 AGGGCTATGTGGAATATGAGTGG - Intergenic
1137592198 16:49700485-49700507 AGGGGCAGCTGGAATACAGGGGG + Intronic
1139125567 16:64072647-64072669 CGGGCCAGGTGGAGTTCGGGTGG - Intergenic
1139342614 16:66278327-66278349 AGGGCCTTGTGCAAGAAGGGTGG - Intergenic
1139531213 16:67543587-67543609 AGGGCCAGGTGGAGCATGTGAGG + Intronic
1141992505 16:87618570-87618592 GTGGCCAGGTGGAAAAAGGCTGG - Intronic
1143548305 17:7613501-7613523 AGGGGGAGGTGAAATAAGGAAGG + Intronic
1143628146 17:8122486-8122508 AGTGGCAGGGGGAAGAAGGGAGG + Intronic
1144753893 17:17668106-17668128 AGGCCCAGGTGTAAGGAGGGAGG - Intergenic
1144784252 17:17823195-17823217 AGGACCAGGAGGAAGCAGGGAGG - Intronic
1144873978 17:18387414-18387436 GGGGCCAGGTGGCACCAGGGAGG - Intronic
1145041829 17:19582785-19582807 ATGGCCAAGTGGATTAAGGACGG + Intergenic
1145042581 17:19587925-19587947 ATGGCCAAGTGGATTAAGGACGG - Intergenic
1145733940 17:27213052-27213074 AGGGTTAGATGGATTAAGGGCGG + Intergenic
1145824779 17:27868660-27868682 AGGGGCAGGAGGAACAAGTGGGG - Intronic
1146603848 17:34241177-34241199 AGGGCCAGCTGGAGTCAGCGGGG + Intergenic
1147310430 17:39592817-39592839 AGGGCAAGGTGGCATATGGAAGG - Intergenic
1148122097 17:45219324-45219346 AAGGCCTGGTGGAATAAAGCTGG - Intergenic
1148826170 17:50396040-50396062 AGGGCAGGGTGAAATAAGGCTGG + Intronic
1149172050 17:53823310-53823332 AGAGCCAAGGGGGATAAGGGCGG - Exonic
1152567430 17:81106554-81106576 ATGGCCAGGAGGAGGAAGGGAGG + Intronic
1153734203 18:8047595-8047617 GTGACCAGGTGGAATGAGGGTGG + Intronic
1154291385 18:13110921-13110943 AGAGGCAGGTGGAAGAAGGTGGG - Intronic
1154435806 18:14340861-14340883 AGGGCCAAGGGGAACCAGGGGGG + Intergenic
1158482044 18:57830745-57830767 AGGGCCACGTGGGATGAGGTTGG + Intergenic
1159037402 18:63290880-63290902 AGGGCCGAGTGGGATGAGGGTGG - Intronic
1160006931 18:75074884-75074906 CGGGCCAGGAGGAGTGAGGGTGG + Intergenic
1160816517 19:1038477-1038499 GGGGCCAGGTGGAGAAAGTGAGG + Exonic
1161638482 19:5404451-5404473 GGGGCCAGGTGGGATTTGGGAGG - Intergenic
1162376722 19:10309504-10309526 AGGGCCGGGTGAAATTAGGGAGG - Exonic
1162500786 19:11052469-11052491 ATGGCCAGGTGGAGGAAGGAGGG - Intronic
1163325400 19:16600154-16600176 AGGGCCCGGGGGGATGAGGGGGG - Intronic
1166002272 19:39884887-39884909 AGGACCAGCTGGACCAAGGGAGG + Intronic
1166005056 19:39901138-39901160 AGGACCAGCTGGACCAAGGGAGG + Intronic
1166808445 19:45500579-45500601 AGGGTGGGGTGGAATGAGGGTGG + Intronic
1166956690 19:46469841-46469863 AGGGCCAGGCTCAAGAAGGGAGG - Exonic
1167772562 19:51530386-51530408 AGGGCCAGATGGAAGCAGAGTGG - Intronic
1168286842 19:55339500-55339522 AGGTCCAAGTGGAAAGAGGGCGG - Intergenic
925075272 2:1011213-1011235 AGGGCCAGGTGGGAGCAGGGCGG + Intronic
925162307 2:1694508-1694530 AGGGCCAGGTGGGCAGAGGGGGG - Intronic
926156021 2:10454438-10454460 AGGGCCAGGGAGAGTTAGGGAGG + Intergenic
926794595 2:16608473-16608495 ATGGCCAAGTGGAATGAGGACGG + Intronic
934085661 2:88507056-88507078 AGGGCCATGCGGACTAAGTGAGG + Intergenic
934478808 2:94615608-94615630 AGGCCCAGATGGAATTATGGTGG - Intergenic
936491452 2:112976228-112976250 AGGACCAAGTGGAATGAGGGCGG + Intronic
936509431 2:113133195-113133217 ATGGGAAGGTGGAATGAGGGAGG - Exonic
937157169 2:119729421-119729443 AGTGGGAGGTGGAAGAAGGGAGG - Intergenic
937531372 2:122831524-122831546 AGGACCAGGTGAAATAATAGTGG + Intergenic
938198138 2:129350567-129350589 AGGGCAATGTGGAATAAAAGTGG + Intergenic
941386384 2:164857781-164857803 AGAAACAGGTGGAATCAGGGAGG + Intergenic
943412045 2:187557642-187557664 AGGGCTAAATGGATTAAGGGCGG + Intronic
943578215 2:189654220-189654242 AGGGCTAAATGGATTAAGGGCGG + Intergenic
943977720 2:194505104-194505126 AGGGTTAAGTGGATTAAGGGTGG - Intergenic
945240998 2:207676887-207676909 GGGGCCAGGGGGAATCAGGAAGG - Intergenic
945717012 2:213369803-213369825 GGGGGCAGGTGGTATATGGGTGG - Intronic
945919113 2:215737651-215737673 GGAGCCAGGTGGGATCAGGGAGG - Intergenic
947872950 2:233449811-233449833 AGGACCAGGGGGAAGATGGGTGG + Intronic
948049581 2:234969455-234969477 ATGGGCAGGAGGAACAAGGGTGG - Intronic
948100127 2:235366577-235366599 AGGGCCAGGTGGAGTCACCGTGG - Intergenic
948145352 2:235704123-235704145 AGGGCCAGGTGGGAGAAGCAGGG + Intronic
948428299 2:237902256-237902278 AGGGCGAGGTGGAAGAGGGAGGG + Intronic
948787265 2:240359132-240359154 TGGGCCTGGTGGCATGAGGGCGG - Intergenic
948826554 2:240575881-240575903 AGGGCCTGGTGCAGGAAGGGCGG + Intronic
1168772403 20:423790-423812 AGGCCCAGGTGAAATCAGCGAGG - Intronic
1168868070 20:1105909-1105931 ATGGCCTGGTGGAAAAAGGCTGG - Intergenic
1169086278 20:2825483-2825505 AGGGTTAGATGGATTAAGGGCGG + Intergenic
1170587489 20:17745700-17745722 GGGGGCAGGGGGAATGAGGGGGG + Intergenic
1170607099 20:17882571-17882593 AGTGCCTGGTGGAGGAAGGGAGG - Intergenic
1170813389 20:19692943-19692965 ATGGCCAGGTGGGAAAAGAGAGG - Intronic
1171114795 20:22515807-22515829 AGGGCCAGGTACCAAAAGGGAGG - Intergenic
1171201454 20:23245259-23245281 ACGGGCAGGAGGAATAAGGCAGG - Intergenic
1171252086 20:23656212-23656234 AGGGCCAAGTGGCCAAAGGGAGG - Intergenic
1171312130 20:24153050-24153072 AGGGCAAGGAGGAGAAAGGGTGG - Intergenic
1171463069 20:25309656-25309678 AGGGCCAGGAGGAGACAGGGAGG + Intronic
1171794390 20:29555146-29555168 AGGGCAAGAAGGAATATGGGAGG - Intergenic
1171854085 20:30329245-30329267 AGGGCAAGAAGGAATATGGGGGG + Intergenic
1172026900 20:31954746-31954768 AGGTGGAGGTGGAATAATGGAGG + Intergenic
1172671150 20:36635262-36635284 AGGACAAGGGGGAAGAAGGGAGG - Intronic
1173017316 20:39237417-39237439 AGGGTCAGGTGGACTAATGTTGG + Intergenic
1173687414 20:44933198-44933220 AGGGCCAAGGGGAATGGGGGTGG + Intronic
1173902192 20:46599017-46599039 AGGGGCAGTTTGAATATGGGTGG - Intronic
1175738093 20:61401005-61401027 AGGGCCAGGTGTGAAATGGGTGG - Intronic
1176140342 20:63542132-63542154 AGGGCCACGTGGCAGCAGGGAGG + Intronic
1180953852 22:19732624-19732646 AGGGCCAGCTGGACAAAAGGTGG + Intergenic
1181409702 22:22710330-22710352 AGGGCCAGGTGAACTAGGGAGGG + Intergenic
1181417154 22:22768511-22768533 AGGGCCAGGTGAACTAGGGAAGG + Intronic
1181998001 22:26898101-26898123 AGGGCCAGGAGCAAGATGGGAGG + Intergenic
1182458215 22:30466085-30466107 ATGGACAGGAGAAATAAGGGAGG + Intronic
1184880582 22:47301995-47302017 AGGGCCAGGGGGCATAGGGATGG + Intergenic
1185116078 22:48939068-48939090 AGGCCCAGGAGGAAAAAGGAAGG + Intergenic
1185285477 22:49997962-49997984 GGGGCCAGGGGGCATCAGGGCGG - Intronic
951264090 3:20547541-20547563 AGGGTTAAGTGGATTAAGGGCGG - Intergenic
951541856 3:23789529-23789551 TGGGGCAGTTGGAATAAGAGAGG - Intergenic
951614077 3:24522316-24522338 AGCGCCAGGAGGAATAAGTCAGG - Intergenic
952970528 3:38648162-38648184 AGTGCGAGGTGGAATGAGGGTGG - Intronic
954266180 3:49471946-49471968 AGGGCCAGCAGGAATTAGTGGGG + Intronic
954448016 3:50557073-50557095 AGGGGCCTGTGGAATAAGGCTGG - Intergenic
954574500 3:51668255-51668277 GGGTCCAGGTGGGTTAAGGGGGG + Exonic
954636609 3:52074321-52074343 AGGGCCACGTGGGAAAAGTGCGG + Intergenic
955658933 3:61276098-61276120 ATGGGCAGGTGGAAACAGGGAGG + Intergenic
960087980 3:113611153-113611175 AGAGCCAGGTGGAAGAAGGTGGG - Intronic
960392129 3:117090437-117090459 AGGGCCAGGTGGCATGAGTCTGG - Intronic
961321674 3:126081355-126081377 CGGGACAGGGGGAAAAAGGGAGG + Intronic
961647813 3:128401730-128401752 ATAGCCAGGTGGGATGAGGGAGG + Intronic
962823829 3:139080809-139080831 AAGCCCAGGGGGAATAATGGTGG + Intronic
962894052 3:139698296-139698318 AGGGACAGGTGCAGAAAGGGTGG - Intergenic
964415513 3:156443836-156443858 AAGGCCAGGAGAAATAAAGGTGG - Intronic
966406586 3:179604786-179604808 ACGGGCAGGAGGAAGAAGGGAGG - Exonic
967351288 3:188516584-188516606 TGGGGCAGGGGGAGTAAGGGTGG - Intronic
967530884 3:190547920-190547942 AGGGTCTGATGGAGTAAGGGGGG + Intronic
969507551 4:7597573-7597595 AGGGGCTGTTGCAATAAGGGAGG + Intronic
969508225 4:7601923-7601945 AGGGTTAGATGGATTAAGGGCGG - Intronic
981802894 4:148678910-148678932 AGGGACATGTGAAATACGGGTGG + Intergenic
985195925 4:187429204-187429226 AGGGCCTGGTGGAAGGAGTGTGG - Intergenic
986157669 5:5192566-5192588 AGTCAGAGGTGGAATAAGGGAGG - Intronic
988981378 5:36572740-36572762 ATGGGCAGGTGGAATAGGGATGG - Intergenic
989115707 5:37950489-37950511 ATGGGAAGGTGGAAGAAGGGTGG + Intergenic
989119599 5:37991095-37991117 AAGGGCAGGTGGAATCAGAGAGG + Intergenic
989973356 5:50551832-50551854 AGGGTGAGGTGGAAGAAGGAAGG + Intergenic
990782387 5:59379968-59379990 AGGGGAAAGGGGAATAAGGGAGG - Intronic
993779096 5:92043204-92043226 AGGGACAAGTGGAATGAAGGAGG - Intergenic
996275347 5:121660047-121660069 AGGGCAAGGTGAAACAAGGTGGG + Intergenic
997964258 5:138345259-138345281 AGGGCCAGGCTGAAGAAAGGAGG - Exonic
999325191 5:150639388-150639410 TGGGCCAGGTTGAACAGGGGAGG + Intronic
1001249528 5:170136053-170136075 AGGGCCAGCAGGAAGGAGGGGGG + Intergenic
1001541474 5:172542787-172542809 AGGGCCAGGTGGCAGAGGGGCGG + Intergenic
1001690433 5:173628802-173628824 AGGGACAGGCGGAATGAGGTTGG + Intergenic
1001701886 5:173712668-173712690 AGGGCGAGTTGGAAGCAGGGAGG + Intergenic
1002425366 5:179171696-179171718 AGGGCCAGGCAGAAAAAGGTGGG + Intronic
1003245138 6:4376690-4376712 AGGGCCAGGTGGAACAGGAAGGG - Intergenic
1004152604 6:13134533-13134555 AGGGTTAAGTGGATTAAGGGCGG + Intronic
1004907850 6:20253238-20253260 AGGCTCAGGTGGAGTCAGGGAGG - Intergenic
1005887137 6:30105877-30105899 GGAGCCAGGTGGGGTAAGGGGGG + Intronic
1007127825 6:39442126-39442148 CGGGCTGGGTGGAATAAAGGGGG + Intronic
1007341554 6:41194148-41194170 AGGGGCAGGGGAAAGAAGGGTGG - Intronic
1008206314 6:48662950-48662972 ATGGTCAGGAGGAAGAAGGGTGG - Intergenic
1008845495 6:55957994-55958016 AGGGGCATGTGTAATAAGGAAGG + Intergenic
1008926105 6:56893851-56893873 AGGGTTAGATGGATTAAGGGCGG - Intronic
1009689521 6:67010325-67010347 AGGGTGAGATAGAATAAGGGTGG - Intergenic
1009900580 6:69803547-69803569 AGGGCCAGGAGGTATAACAGTGG + Intergenic
1010508087 6:76685277-76685299 AGGGGAAGGTGGATAAAGGGAGG - Intergenic
1011407436 6:87030802-87030824 AGGGACAGGTAGAAAAAGGGTGG - Intergenic
1012529757 6:100221258-100221280 AAGGGCTGGTGGACTAAGGGAGG - Intergenic
1013461145 6:110376594-110376616 AGGGGGAGGTGGAATGTGGGAGG + Intergenic
1013582059 6:111545409-111545431 GGGGCCAGGTGGGTTAAAGGTGG - Intergenic
1014575147 6:123060094-123060116 AGGGCCAAGGGGAATCAGTGTGG - Intronic
1014634526 6:123828799-123828821 AAGGCCAGCTGGGGTAAGGGGGG - Intronic
1014999790 6:128200866-128200888 AGGGTGAGGAGGAAGAAGGGAGG + Intronic
1015067616 6:129050430-129050452 AGATCCAGGAGGAATAAGGTAGG + Intronic
1015768982 6:136749780-136749802 AGGGCCAGGATGAATAAGGCTGG + Intronic
1017528974 6:155268690-155268712 AGGGTTAAGTGGATTAAGGGCGG + Intronic
1017767791 6:157621026-157621048 AGGGGAAGGTGGAGTAAGGCAGG + Intronic
1018580992 6:165308330-165308352 AGGGAGAGGTGGAAGAAAGGGGG + Intronic
1018902142 6:168057025-168057047 AGGGCCATGTGGAAGTGGGGTGG + Exonic
1019210116 6:170397993-170398015 AGGCCCAGGGGGAAGAAAGGGGG - Intronic
1019442067 7:1052515-1052537 AGGGCCTGGCGGAAGAAGTGGGG + Intronic
1019504233 7:1382806-1382828 AGGGGCAGGTGTAATTGGGGTGG + Intergenic
1019840001 7:3431662-3431684 ATAGCCTGGTGGACTAAGGGAGG + Intronic
1020157373 7:5737263-5737285 AGGGTTAAATGGAATAAGGGCGG + Intronic
1021516777 7:21498099-21498121 AGGGCTGGTTGTAATAAGGGGGG - Intronic
1021608313 7:22431871-22431893 TGGGCCAGATGGGATAAGGGAGG - Intronic
1021922298 7:25497517-25497539 AGTGGCAGGTGGATGAAGGGAGG - Intergenic
1022654384 7:32305649-32305671 AGGGACAGCTGGAAAGAGGGTGG - Intergenic
1024051181 7:45624342-45624364 AGGGGCAGGGGGAAGGAGGGTGG + Intronic
1025772700 7:64528102-64528124 AGAGCCAAGTGAAATATGGGGGG + Intronic
1026647665 7:72186296-72186318 ATGGACAGGTGGGAAAAGGGAGG + Intronic
1027336213 7:77153144-77153166 AGGAGGAGGTGGAAGAAGGGAGG + Intronic
1027565311 7:79784617-79784639 AGGGGAAGCTGGAATCAGGGTGG - Intergenic
1029779574 7:102717958-102717980 AGGAGGAGGTGGAAGAAGGGAGG - Intergenic
1032704096 7:134407081-134407103 TTGGCCAAATGGAATAAGGGAGG + Intergenic
1032734141 7:134674406-134674428 AGGGCTGGGTGGAATAGGGGAGG - Intronic
1033566910 7:142587590-142587612 AGGGCCAGATGGGATGAGGTAGG + Intergenic
1036479648 8:9127753-9127775 AGCACCATGTTGAATAAGGGTGG - Intergenic
1041369785 8:57147168-57147190 AGGGCCAGGTAGCAGAAAGGAGG + Intergenic
1041516924 8:58710753-58710775 AGGGGGAGGTGGAGGAAGGGTGG + Intergenic
1042460059 8:69054852-69054874 TGGGCCAGGTGCAATATGAGAGG + Intergenic
1048219642 8:132529463-132529485 AGGGGCATGTGGAGTAGGGGAGG + Intergenic
1049508929 8:143018272-143018294 AGGGCCGGGTGGAAGGAGGCCGG + Intronic
1051710335 9:19924697-19924719 AGGCCCAGGGTGAATAAAGGAGG + Intergenic
1051993026 9:23176485-23176507 AGGGGCAGGAGGAAGATGGGAGG - Intergenic
1053531353 9:38884540-38884562 AGTGGCATCTGGAATAAGGGAGG + Intergenic
1053609941 9:39702089-39702111 AGTGCTTGGTGGCATAAGGGAGG - Intergenic
1053679260 9:40470480-40470502 AGGACCAGATGGAATTATGGTGG + Intergenic
1053791889 9:41692526-41692548 AGGGCAAGAAGGAATATGGGAGG + Intergenic
1053929250 9:43098825-43098847 AGGACCAGATGGAATTATGGTGG + Intergenic
1054088313 9:60769061-60769083 AGTGCTTGGTGGCATAAGGGAGG + Intergenic
1054153261 9:61622239-61622261 AGGGCAAGAAGGAATATGGGGGG - Intergenic
1054180296 9:61904545-61904567 AGGGCAAGAAGGAATATGGGGGG + Intergenic
1054203577 9:62108969-62108991 AGTGGCATCTGGAATAAGGGAGG + Intergenic
1054243583 9:62640306-62640328 AGTGCTTGGTGGCATAAGGGAGG + Intergenic
1054292340 9:63306018-63306040 AGGACCAGATGGAATTATGGTGG + Intergenic
1054473060 9:65553443-65553465 AGGGCAAGAAGGAATATGGGGGG - Intergenic
1054505359 9:65905815-65905837 AGGACCAGATGGAATTATGGTGG - Intergenic
1054557706 9:66674851-66674873 AGTGCTTGGTGGCATAAGGGAGG + Intergenic
1054634785 9:67479395-67479417 AGTGGCATCTGGAATAAGGGAGG - Intergenic
1054657296 9:67676597-67676619 AGGGCAAGAAGGAATATGGGGGG - Intergenic
1055235499 9:74117742-74117764 AGAGGCAGATGGAATAATGGAGG + Intergenic
1057021143 9:91698635-91698657 AGGAGCAGGTGGAAGGAGGGTGG - Intronic
1057835900 9:98445169-98445191 AGGGCCAGGTGAAGTACGAGGGG + Intronic
1059672535 9:116505347-116505369 AGGGAGAGGTGGAAACAGGGAGG - Intronic
1060490920 9:124083511-124083533 AGGGCCAGCTGAAGTAGGGGTGG - Intergenic
1061035756 9:128113595-128113617 ATGGCCAGGGGGAATGAAGGAGG + Intergenic
1061407794 9:130402351-130402373 AAGGCCAGGAGGATAAAGGGAGG + Intronic
1061506540 9:131034824-131034846 AGAGACAGGTGGAATCAGGCAGG - Intronic
1061926500 9:133808466-133808488 AGGCCCAGGTGGGGTAGGGGAGG + Intronic
1061927786 9:133814553-133814575 CAGGCCAGGTGGAAGGAGGGGGG + Intronic
1062588733 9:137263503-137263525 AGGGCCAGGGGGAAGGAGGGAGG - Intronic
1186664556 X:11704277-11704299 ATGGCCAGGGGGAAGAAGGTTGG + Intergenic
1186792029 X:13008903-13008925 AGGACCAGGTGGAAGATGTGAGG + Intergenic
1187666689 X:21619892-21619914 AGGGACAGCTGGAATCAGTGTGG + Intronic
1187844744 X:23523851-23523873 AGGGCTAAATGGATTAAGGGTGG + Intergenic
1188985640 X:36766247-36766269 AGGGACATGCAGAATAAGGGAGG - Intergenic
1190016643 X:46833112-46833134 AAGGCCATGAGGAATCAGGGTGG + Intergenic
1190321467 X:49182340-49182362 ACAGCCTGGAGGAATAAGGGTGG - Intronic
1190328344 X:49220440-49220462 AGGGCCAGGTGGAGCAGGTGTGG - Intronic
1190642692 X:52495699-52495721 AGGGCAAGGCGGGATAAGGAGGG + Exonic
1190644981 X:52517168-52517190 AGGGCAAGGCGGGATAAGGAGGG - Exonic
1192107274 X:68327520-68327542 AGGGTTAGATGGATTAAGGGCGG + Intronic
1193924504 X:87466607-87466629 AGGGTTAGATGGATTAAGGGCGG + Intergenic
1194752774 X:97703280-97703302 AGGGTGAGCTAGAATAAGGGTGG + Intergenic
1196809245 X:119615537-119615559 AGGCCCAGCTGGAATAAAGTTGG + Intergenic
1197727796 X:129787960-129787982 AGGGAGAGCTGGAAAAAGGGTGG - Exonic
1199599236 X:149531933-149531955 AGGGCCAGGTGGGATTTGGTAGG - Intronic
1200411968 Y:2869741-2869763 AGAGACAGATGGAAGAAGGGAGG + Intronic