ID: 1130647339

View in Genome Browser
Species Human (GRCh38)
Location 15:85740788-85740810
Sequence GCAGTCAGTGGTATTACCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 128}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130647339_1130647346 30 Left 1130647339 15:85740788-85740810 CCCCAGGTAATACCACTGACTGC 0: 1
1: 0
2: 0
3: 16
4: 128
Right 1130647346 15:85740841-85740863 CGTGAGTTCCTGCACCTTTGAGG 0: 1
1: 0
2: 0
3: 5
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130647339 Original CRISPR GCAGTCAGTGGTATTACCTG GGG (reversed) Intronic
900986250 1:6074279-6074301 GCAGTCAGATGTATTTGCTGGGG + Intronic
901415276 1:9112097-9112119 GCAGACAGTGGTACTGCGTGAGG + Intronic
905091036 1:35431705-35431727 GAAGACAGGGGCATTACCTGGGG + Intergenic
905230857 1:36514294-36514316 GCTGTCAGAGGTGCTACCTGAGG + Intergenic
908427241 1:64018999-64019021 GCTGTAATTGGTATCACCTGGGG + Intronic
908472698 1:64459574-64459596 CCAGTCAGTGCTATGAGCTGAGG + Intergenic
917689748 1:177456586-177456608 TCGGACAGTGGTATTGCCTGAGG + Intergenic
918821226 1:189257066-189257088 GTTATCAGTGGTATTATCTGGGG + Intergenic
919226432 1:194709820-194709842 GCAGACTGTGGTATTTCATGCGG - Intergenic
919445468 1:197699440-197699462 CCATTCAGTGATATTAGCTGTGG - Intronic
919502059 1:198349710-198349732 CCAGTCAATGGTATTTGCTGTGG - Intergenic
919547971 1:198947788-198947810 GCATTCAGTGGTGTTATTTGAGG - Intergenic
919572162 1:199262507-199262529 GCAGACAGTGGGATTGCCAGTGG - Intergenic
920447529 1:206030184-206030206 GAAGTCAGTGTTCTTAACTGTGG + Intergenic
922790989 1:228310983-228311005 GCAGTCAGTTCTGTTGCCTGTGG + Intronic
923025269 1:230198591-230198613 GCAGTCTGTGGGACCACCTGAGG + Intronic
1067574425 10:47400277-47400299 GCAGGCAGTGACATTCCCTGTGG + Intergenic
1068171787 10:53403948-53403970 GCAGGCAGTGGTGATATCTGAGG - Intergenic
1075752723 10:124786579-124786601 GCAGGCAGATGGATTACCTGAGG + Intronic
1078723030 11:13901552-13901574 ACTGTCAGTGGTAAGACCTGTGG + Intergenic
1082642850 11:55686005-55686027 GCAGTCAGTGAGATTCCATGGGG - Intergenic
1084880446 11:72167684-72167706 CAAGTCAGGGGTATCACCTGAGG - Intergenic
1090274448 11:125409745-125409767 GCTGACAGTGGAATCACCTGGGG + Intronic
1090394510 11:126409713-126409735 ACAGTCAGTGGTCTGATCTGTGG + Intronic
1092604303 12:10101861-10101883 GCAGGAAGTGGTAATAGCTGAGG - Intronic
1093460482 12:19403127-19403149 GCAGGCAGTGGCAATAGCTGAGG + Intergenic
1093637501 12:21488875-21488897 GCAGTCAGTGGTAAGACATGTGG - Intronic
1094443069 12:30500782-30500804 GCAGGCAGTGGGGTTACCTAGGG - Intergenic
1097042167 12:56162326-56162348 GCATTCTGTGTTCTTACCTGTGG - Intronic
1098223660 12:68298192-68298214 GCAGGCAGTGGTGATAGCTGAGG - Intronic
1100806038 12:98284643-98284665 GGAGTCAGTGGTCTTAGTTGGGG - Intergenic
1104322717 12:127766872-127766894 TCAGTCACTCATATTACCTGGGG + Intergenic
1104577989 12:129985815-129985837 GCAGTCAGTGAGTTTTCCTGTGG - Intergenic
1105211940 13:18262059-18262081 GCTGTCAGTGGCAGTGCCTGGGG - Intergenic
1109483252 13:62984676-62984698 GAAGTCAGTGGTACTTCCAGTGG - Intergenic
1113225102 13:108151132-108151154 GCATTCAGTGATATCACCTGAGG - Intergenic
1118440178 14:65804924-65804946 GCAGTGGGTGGCATTGCCTGTGG - Intergenic
1118502705 14:66378234-66378256 GCTGTGAGTGGGAATACCTGTGG - Intergenic
1121551695 14:94807647-94807669 GCAGTCAGAGGACTTGCCTGTGG - Intergenic
1126594301 15:50370201-50370223 GCTGTAAGTGGTATTAAATGTGG + Intergenic
1128378507 15:67094113-67094135 GCAGGCAGTGGGACCACCTGAGG + Intronic
1130647339 15:85740788-85740810 GCAGTCAGTGGTATTACCTGGGG - Intronic
1131535270 15:93232225-93232247 GCAGCCAGAGGTATTGTCTGTGG - Intergenic
1137816004 16:51397944-51397966 GTAGTCAATGGTATTTCCAGGGG + Intergenic
1142662823 17:1443211-1443233 GAAGTCGGTGGGATCACCTGAGG - Intronic
1152155155 17:78628301-78628323 GCAGGCAGCGGCATTACCTGAGG + Intergenic
1152594832 17:81233015-81233037 GCAGGCAGTGGTGCCACCTGTGG + Intronic
1153059853 18:983606-983628 GTAGACAGGGGTACTACCTGTGG - Intergenic
1153667414 18:7378746-7378768 GCAGTCAGAGTTGTTACCTTGGG + Intergenic
1155636043 18:27956683-27956705 GCAGTCAGAGGTCTTACTTGCGG - Intronic
1158306782 18:56114936-56114958 ACAGACAGTGGTATTAAATGAGG + Intergenic
1160106161 18:75978814-75978836 GGAGTGAATGATATTACCTGGGG - Intergenic
1165931093 19:39359238-39359260 GCAGGCAGTTGGATTACCTCTGG + Intronic
1166960075 19:46491946-46491968 GCAGCCTGTGGTGTTGCCTGTGG - Exonic
1167752437 19:51389009-51389031 GCAGCCAGTGGTGTTTCCAGGGG + Exonic
926990719 2:18677021-18677043 GCAGGCAATGGCAATACCTGAGG + Intergenic
928308376 2:30190192-30190214 ATAGGCAGGGGTATTACCTGAGG + Intergenic
928721245 2:34124168-34124190 GCAGACATTTGTATTACCTCAGG + Intergenic
928866035 2:35918767-35918789 GCAGACAATGTTAGTACCTGTGG - Intergenic
939066775 2:137492885-137492907 GCCGACATGGGTATTACCTGAGG + Intronic
939074000 2:137578599-137578621 GCAGGCAGTAATGTTACCTGTGG - Intronic
940129655 2:150366614-150366636 TCAGCCATTGGTATCACCTGGGG - Intergenic
940329027 2:152454836-152454858 GCAGTCAGTGCTCTTCTCTGAGG - Intronic
940366189 2:152851628-152851650 GCAGACAGTGGTGATAGCTGAGG + Intergenic
940706243 2:157108156-157108178 GCAGGCAGTGGTGATAGCTGAGG - Intergenic
941780147 2:169435081-169435103 CGAGGCAGTTGTATTACCTGAGG + Intergenic
942124789 2:172812694-172812716 GATGTCAGTGGTATTACTTAGGG + Intronic
946603711 2:221378777-221378799 GCAGACTGTGGCATTGCCTGGGG + Intergenic
946717652 2:222569642-222569664 GCAGTCAGTTCTCTTTCCTGAGG + Intergenic
947431882 2:230036839-230036861 GCACTAAATTGTATTACCTGTGG + Exonic
1174116725 20:48231317-48231339 GCAGGTAGTGCTCTTACCTGGGG - Intergenic
1185377969 22:50491013-50491035 TCAGGCAGTGGTGTTTCCTGAGG + Intergenic
950496792 3:13338710-13338732 GCAGGCAGAGGTTTCACCTGCGG - Intronic
952422614 3:33145342-33145364 GGAGTCAGTGTTATTACTGGTGG + Exonic
954517339 3:51190518-51190540 GCAGGCAATGGTAATACCTGAGG + Intronic
955814268 3:62825473-62825495 GCATGCATTGGAATTACCTGGGG - Intronic
958728068 3:97930525-97930547 GCAGTCAGTGGTGTCTACTGAGG + Intronic
958768188 3:98395814-98395836 GCAGGCAGTGGTGGTAGCTGAGG - Intergenic
959374438 3:105571132-105571154 GCAGGCAGTGGAATCACCTGAGG + Intronic
959740697 3:109715897-109715919 GCATTCAGTGGGATGGCCTGGGG + Intergenic
961904481 3:130248449-130248471 GGAGCCAGTGGTATGAGCTGGGG + Intergenic
962041362 3:131710758-131710780 GAAGTCAGTGGGAAGACCTGGGG + Intronic
963056170 3:141188138-141188160 GGAGTCAGGGGTCCTACCTGAGG + Intergenic
964635968 3:158858963-158858985 GCAGGCAGTGGTCATAGCTGAGG + Intergenic
965568667 3:170149325-170149347 GCAATCAATGGTATAAACTGTGG + Intronic
968595780 4:1482454-1482476 CCATTCAGCGGTATTAGCTGTGG + Intergenic
970945875 4:21691103-21691125 CCAGTCAGTGGTAATACCAGTGG + Intronic
971124357 4:23736469-23736491 GCTGTCAGCCGTTTTACCTGAGG + Intergenic
972020564 4:34308453-34308475 GCAGTCATTGGCATGAGCTGTGG + Intergenic
973627271 4:52785337-52785359 CAATTCAGTGGTATTACGTGGGG + Intergenic
974231848 4:59126366-59126388 CTATTCAGTGATATTACCTGTGG - Intergenic
974490367 4:62557081-62557103 GCAGGCAGTGGTGATAGCTGAGG + Intergenic
975593597 4:76025058-76025080 TAAGTCAGTGGAATTAGCTGTGG + Intronic
979195543 4:117916466-117916488 GCAGACAGTGGTGATAGCTGAGG + Intergenic
982135578 4:152271376-152271398 GCAGTCAGTGGGAATATCTATGG + Intergenic
985394805 4:189530972-189530994 GCAGGCAGTGGTGATAGCTGAGG + Intergenic
986004135 5:3653768-3653790 GGAGTAAGTGGTTTTACTTGGGG + Intergenic
986480628 5:8183506-8183528 GCAGCCACTCATATTACCTGAGG - Intergenic
986550518 5:8949353-8949375 GCAGTCATTGGTATTCCCATGGG - Intergenic
993086050 5:83365127-83365149 ACAGTAAGTGGTGTTTCCTGAGG - Intergenic
993929394 5:93919080-93919102 GCTGACACTGGAATTACCTGTGG - Intronic
994890145 5:105623071-105623093 GCACTCAGGAGAATTACCTGAGG - Intergenic
997043774 5:130289249-130289271 GCACTCTGGGGAATTACCTGGGG - Intergenic
999661771 5:153871804-153871826 TAAATCAGTGCTATTACCTGTGG - Intergenic
1000430708 5:161148810-161148832 GCAGGCAATGGTATAACCTGGGG - Intergenic
1006176593 6:32126100-32126122 GCAGGCTGTTTTATTACCTGAGG + Exonic
1010506834 6:76671025-76671047 AGATTCAGTGGTATTACCTGGGG - Intergenic
1010626153 6:78138385-78138407 ACAATCTGTGGTATTACCTGAGG + Intergenic
1012185452 6:96209577-96209599 GGAGTCATTGGAAATACCTGAGG + Exonic
1015070145 6:129083366-129083388 AAAGTCAGTGGTATTCCCTGAGG - Intronic
1015637455 6:135291625-135291647 GAAGTCTGTGGTATTCTCTGTGG + Intronic
1018030418 6:159837039-159837061 TCAGTCAGTGGGATGCCCTGCGG - Intergenic
1021464615 7:20928117-20928139 GCAGTTGGTGGCATTTCCTGAGG + Intergenic
1022335987 7:29422683-29422705 GATGTCAGGGCTATTACCTGTGG + Intronic
1024631854 7:51255743-51255765 GCACTCAGTGGTGTCACCTCAGG + Intronic
1024909398 7:54427995-54428017 GCAGTGAGTGGGATTTCATGTGG - Intergenic
1028291017 7:89065234-89065256 TCATTCAGTGGTATTACCACTGG + Intronic
1029235387 7:99111998-99112020 GTACTCATTGCTATTACCTGGGG + Intronic
1030532898 7:110732238-110732260 TCATTCAGTGTTATTACCTGAGG - Intronic
1032482948 7:132261563-132261585 GCAGACAGTGGAAATACCTTGGG - Intronic
1033536729 7:142319789-142319811 GCAGTCTGTGCTATTTGCTGTGG - Intergenic
1038287424 8:26218057-26218079 GGAGTCAGTGGTAGCAACTGGGG + Intergenic
1039347566 8:36724735-36724757 GCAGTCATTGGATTTATCTGAGG - Intergenic
1044026226 8:87175668-87175690 GCCATCAGTTGTATTGCCTGGGG + Intronic
1044830566 8:96243902-96243924 GCTGTGAGTGGCATTACCTGTGG + Exonic
1044952920 8:97451214-97451236 GCAGTCATTGGAATCACCTGGGG - Intergenic
1046194023 8:110835316-110835338 GTTGTCTGTGGAATTACCTGTGG + Intergenic
1048192759 8:132305320-132305342 ACAGTCAGTGGTCTTATCTGTGG - Intronic
1054931839 9:70643123-70643145 GCAGTCCCTGTTGTTACCTGAGG - Intronic
1058599440 9:106653489-106653511 GCACACACTGGTATTCCCTGGGG + Intergenic
1061173264 9:128974991-128975013 GGAGGCAGTGGGATCACCTGAGG - Intronic
1186843540 X:13508857-13508879 GCAGGTAGTGGAATTACCTCCGG - Intergenic
1187424629 X:19165963-19165985 GCAGACAGTGGTGTGGCCTGGGG + Intergenic
1188310322 X:28609376-28609398 GTTGTCAGTGGTATAACCTCTGG - Intronic
1188764793 X:34078439-34078461 GTAGTAAGTGGTATTTCATGTGG + Intergenic
1192634401 X:72804166-72804188 GCAGTCTGTAGAATTACCTCAGG + Intronic
1192647309 X:72916635-72916657 GCAGTCTGTAGAATTACCTCAGG - Intronic
1193057375 X:77168154-77168176 GCAGGCAGTGGTAATAGCTGAGG + Intergenic
1194901766 X:99520671-99520693 GCAGGCAATGGTAATAACTGAGG - Intergenic
1195141714 X:101967360-101967382 TCCTTCAGTGGTATTAACTGAGG - Intergenic
1197295019 X:124708043-124708065 GCAGTCTACCGTATTACCTGGGG + Intronic
1200309779 X:155066247-155066269 GCAGTCAGCAGCACTACCTGAGG - Intronic
1200549275 Y:4558599-4558621 GCAGTCTGGGGTATTGCCTCAGG + Intergenic
1201720895 Y:17095746-17095768 TCAGACACTGTTATTACCTGGGG + Intergenic
1202021177 Y:20466554-20466576 GCAATCAGTGGAAGTTCCTGGGG + Intergenic