ID: 1130647736

View in Genome Browser
Species Human (GRCh38)
Location 15:85743567-85743589
Sequence GCACCTTCCATAGCCAAATC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 90}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130647731_1130647736 -9 Left 1130647731 15:85743553-85743575 CCCCCTCGCCATCTGCACCTTCC 0: 1
1: 0
2: 2
3: 42
4: 456
Right 1130647736 15:85743567-85743589 GCACCTTCCATAGCCAAATCAGG 0: 1
1: 0
2: 0
3: 5
4: 90
1130647728_1130647736 6 Left 1130647728 15:85743538-85743560 CCAGTCCTGAGGAGCCCCCCTCG 0: 1
1: 0
2: 2
3: 6
4: 145
Right 1130647736 15:85743567-85743589 GCACCTTCCATAGCCAAATCAGG 0: 1
1: 0
2: 0
3: 5
4: 90
1130647724_1130647736 19 Left 1130647724 15:85743525-85743547 CCATCGTTCTTCCCCAGTCCTGA 0: 1
1: 0
2: 1
3: 21
4: 197
Right 1130647736 15:85743567-85743589 GCACCTTCCATAGCCAAATCAGG 0: 1
1: 0
2: 0
3: 5
4: 90
1130647726_1130647736 8 Left 1130647726 15:85743536-85743558 CCCCAGTCCTGAGGAGCCCCCCT 0: 1
1: 0
2: 2
3: 15
4: 237
Right 1130647736 15:85743567-85743589 GCACCTTCCATAGCCAAATCAGG 0: 1
1: 0
2: 0
3: 5
4: 90
1130647730_1130647736 -8 Left 1130647730 15:85743552-85743574 CCCCCCTCGCCATCTGCACCTTC 0: 1
1: 0
2: 3
3: 40
4: 432
Right 1130647736 15:85743567-85743589 GCACCTTCCATAGCCAAATCAGG 0: 1
1: 0
2: 0
3: 5
4: 90
1130647723_1130647736 20 Left 1130647723 15:85743524-85743546 CCCATCGTTCTTCCCCAGTCCTG 0: 1
1: 0
2: 0
3: 10
4: 167
Right 1130647736 15:85743567-85743589 GCACCTTCCATAGCCAAATCAGG 0: 1
1: 0
2: 0
3: 5
4: 90
1130647727_1130647736 7 Left 1130647727 15:85743537-85743559 CCCAGTCCTGAGGAGCCCCCCTC 0: 1
1: 0
2: 2
3: 24
4: 353
Right 1130647736 15:85743567-85743589 GCACCTTCCATAGCCAAATCAGG 0: 1
1: 0
2: 0
3: 5
4: 90
1130647732_1130647736 -10 Left 1130647732 15:85743554-85743576 CCCCTCGCCATCTGCACCTTCCA 0: 1
1: 0
2: 1
3: 25
4: 270
Right 1130647736 15:85743567-85743589 GCACCTTCCATAGCCAAATCAGG 0: 1
1: 0
2: 0
3: 5
4: 90
1130647729_1130647736 1 Left 1130647729 15:85743543-85743565 CCTGAGGAGCCCCCCTCGCCATC 0: 1
1: 0
2: 0
3: 28
4: 165
Right 1130647736 15:85743567-85743589 GCACCTTCCATAGCCAAATCAGG 0: 1
1: 0
2: 0
3: 5
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130647736 Original CRISPR GCACCTTCCATAGCCAAATC AGG Exonic
902097731 1:13960448-13960470 GCACCTTCCAAGGACAACTCTGG - Intergenic
905297685 1:36964443-36964465 GCAGCATCCATAGACAAGTCCGG + Intronic
907576657 1:55532689-55532711 TCACCTTCCAAACACAAATCTGG - Intergenic
913010671 1:114680314-114680336 GCCACTTCCTTACCCAAATCTGG - Exonic
920147260 1:203872694-203872716 GCCCCTGCCAGAGCCAAAGCTGG + Intergenic
920970501 1:210739482-210739504 GGACTTTCCATAGCCAGATATGG - Intronic
1062810455 10:459599-459621 GGATCTTCCACAGCCACATCAGG + Intronic
1063601229 10:7483037-7483059 GCACCTTCCAAAACCAACCCCGG - Intergenic
1065072035 10:22035172-22035194 TCACCTACCATAGCCAGATAGGG - Intergenic
1066344216 10:34566773-34566795 GCACCATCCATTCCCACATCAGG + Intronic
1070716088 10:78722366-78722388 GCACTTTCCATAGTGAAAGCAGG - Intergenic
1072990749 10:100190822-100190844 GCACCCAACATAGCCAAAGCAGG + Intronic
1074113230 10:110437333-110437355 GCACCTTCCTTTCCCCAATCAGG - Intergenic
1075611660 10:123859595-123859617 GCTGCTTTAATAGCCAAATCTGG - Intronic
1077523528 11:3050366-3050388 GCACACTCCCTAGCCAAAACTGG + Intronic
1078679856 11:13465159-13465181 GCACCTGCCATAGGCCAATTGGG + Intergenic
1085053209 11:73390308-73390330 GCACTTTCCAGAGCCAGATGTGG + Intronic
1089467271 11:118693310-118693332 CCACCTTCCTTTGACAAATCAGG - Intergenic
1097502759 12:60426591-60426613 GCATATTCCATAGGCAATTCTGG - Intergenic
1098825879 12:75296721-75296743 GCAAGTTCCACAGCCACATCTGG + Intronic
1101399720 12:104376953-104376975 GCCCCTTCCATAGCCTGATTTGG + Intergenic
1102810423 12:115819557-115819579 GCACCTCGCATAGCCAGAGCAGG + Intergenic
1106446148 13:29833201-29833223 GTATTTTCCATAGACAAATCTGG + Intronic
1107008188 13:35638579-35638601 GCATCTTCCAGAGCCAAAGAAGG + Intronic
1112024989 13:95403762-95403784 GCGCCTTACATGGCCAAAGCAGG + Intergenic
1113754047 13:112796803-112796825 ACACCTGCCCTAGCCACATCGGG + Intronic
1114622847 14:24108025-24108047 CTAGCTTCCATAGCCAAATGTGG - Intronic
1115469413 14:33753526-33753548 GAACCTTCCAGAGCCAAAGAGGG + Intronic
1115773073 14:36686814-36686836 TCACCTTCCATCCCCAACTCTGG - Intronic
1117959097 14:61145637-61145659 TCATCTTCCATTGCTAAATCTGG + Intergenic
1119975687 14:79021340-79021362 GCATCTTCCATATCAAAACCAGG - Intronic
1128312931 15:66642859-66642881 GCTCCTTCCAGTGCCAAAGCAGG + Intronic
1130160517 15:81394573-81394595 GCATCTTCCACAGCCAATTCTGG + Intergenic
1130647736 15:85743567-85743589 GCACCTTCCATAGCCAAATCAGG + Exonic
1134246372 16:12543310-12543332 GCACCTTGATTAGCCAAATCTGG + Intronic
1143771297 17:9170669-9170691 GGCACTTCCAGAGCCAAATCTGG - Intronic
1150526401 17:65927183-65927205 GCACCTTACATGGCAAAAGCAGG - Intronic
1151380966 17:73725564-73725586 GCAGCTTCCTTAGCCTCATCAGG - Intergenic
1154106211 18:11525680-11525702 ACACCTTCCATAGACAACTGTGG - Intergenic
1154946488 18:21166709-21166731 GCACCTTACATGGCGAAAGCAGG - Intergenic
1163028382 19:14527637-14527659 GAAGTTTCCAGAGCCAAATCTGG + Intronic
1164640776 19:29824019-29824041 GCACCTTCCATAGCAGCATCGGG - Exonic
1167281938 19:48574378-48574400 GCACCTACAATCTCCAAATCGGG - Intronic
926640923 2:15236058-15236080 GCACCTTATATAGCAAAAGCTGG - Intronic
934184280 2:89657894-89657916 ACGCCTTACATGGCCAAATCAGG + Intergenic
934294567 2:91732032-91732054 ACGCCTTACATGGCCAAATCAGG + Intergenic
934947123 2:98550157-98550179 GGACCCTCCATAGCCCAATCTGG + Intronic
945341299 2:208658758-208658780 GCACTCACCATAGCCAAAACTGG - Intronic
946098187 2:217293474-217293496 GCATCTTCCATAATGAAATCTGG - Intronic
948277756 2:236723073-236723095 GCATTTTCAATAGACAAATCTGG - Intergenic
1169479288 20:5963021-5963043 GCACCTTGCATACCCATAGCAGG + Intronic
1174490860 20:50894112-50894134 GCACCTTACATAGCAAAGGCAGG - Exonic
1181460578 22:23083673-23083695 GCACCTTCCCTGACCACATCTGG - Intronic
1184149979 22:42632097-42632119 GCTCCTTCCCTGGCCCAATCTGG - Intronic
949501429 3:4683745-4683767 GCACCATCCATAGTCTCATCGGG - Exonic
949508997 3:4752295-4752317 GCACCTTCCGTCTCCAAACCTGG - Intronic
949693670 3:6668698-6668720 GCACATTACATAGCAAAAGCAGG - Intergenic
956327787 3:68072217-68072239 CCACCTGCCATTGCCACATCTGG - Intronic
959879658 3:111429079-111429101 GCACCCTCTGTAGCCAAAGCTGG - Intronic
959925791 3:111920276-111920298 GCACATTCCATATCCAACTAAGG - Exonic
960573365 3:119206546-119206568 GCTCCTTCCAAAACCAAATAAGG + Intergenic
961807781 3:129501696-129501718 ACACCTTTTATAGCCACATCTGG - Intronic
966243710 3:177782403-177782425 GCACCTTCCAAAGCCAGGCCTGG - Intergenic
967905257 3:194494215-194494237 GGACCTTCCTCAGCCACATCTGG + Exonic
977403425 4:96564110-96564132 GCTCCTTTCATAGACAAAACTGG - Intergenic
978395647 4:108276947-108276969 GCACTTTCTATGGCCAGATCTGG - Intergenic
982465114 4:155720974-155720996 TCACCTTGCCTAGCCAAAGCAGG - Intronic
984089783 4:175358614-175358636 GCACTTCCCAAAGCCAAAACTGG + Intergenic
984650065 4:182261671-182261693 GCACTATCCAAATCCAAATCGGG + Intronic
987294525 5:16538163-16538185 CCACCTGCCACAGCTAAATCTGG + Intronic
988913723 5:35871528-35871550 GCCACTTTCATAGGCAAATCAGG + Intronic
990240385 5:53811076-53811098 GCACCTTACATGGCCAGAGCAGG + Intergenic
991316420 5:65312423-65312445 GAACCTTCTATACCCACATCTGG + Intronic
994735106 5:103544002-103544024 GCACCATCCATATCCTAATTTGG - Intergenic
996838112 5:127816516-127816538 TCAGCTTCCATTTCCAAATCTGG - Intergenic
1005315555 6:24599659-24599681 GCACCCGCCAGAGCCAAAGCTGG - Intronic
1006885924 6:37382255-37382277 GCACCTCCCCAGGCCAAATCAGG - Intronic
1007961910 6:45967763-45967785 GCACTTTCCATGGCAAAAGCAGG + Intronic
1014040909 6:116823831-116823853 GCACCTTACATGGCCAGATTAGG + Intronic
1014652483 6:124057136-124057158 GCACCCTTTATAGCTAAATCAGG + Intronic
1015319439 6:131855973-131855995 GCACCTCACATACTCAAATCTGG - Intronic
1016732806 6:147444608-147444630 GAACCCTCCATAGCCCAAGCGGG + Intergenic
1021446465 7:20739044-20739066 GAATATTCCAAAGCCAAATCGGG + Exonic
1023295225 7:38708037-38708059 CCACCTTGCATAGCCAGAGCAGG - Intergenic
1027241595 7:76333660-76333682 GCTCCTTCCAAAGCCAAGTCTGG - Intronic
1032577901 7:133075050-133075072 GCACCTTCTATACCCATACCAGG - Intronic
1032829105 7:135604365-135604387 GCACTTTCAAAAGCCAATTCTGG - Exonic
1034415906 7:150964098-150964120 GCCCCTGCCACAGCCAAATGTGG - Intronic
1036036923 8:5029814-5029836 GCATCTTACATAGCCAGAGCAGG - Intergenic
1055856359 9:80692457-80692479 GCATCTTACATAGCCAGAGCAGG - Intergenic
1057823364 9:98352340-98352362 GCAGCTTGCATAGCCACCTCTGG + Intronic
1187078399 X:15959617-15959639 GAACTCTCAATAGCCAAATCTGG + Intergenic
1195347613 X:103966133-103966155 GCACCTACCATCCCCAAGTCAGG - Intronic
1195359829 X:104072708-104072730 GCACCTACCATCCCCAAGTCAGG + Intergenic
1199320394 X:146431132-146431154 GCTGCTTCCAGAGCCAAATGTGG + Intergenic
1200203451 X:154298422-154298444 CCACCTCCCCTAGCCAAAGCTGG - Intronic