ID: 1130651150

View in Genome Browser
Species Human (GRCh38)
Location 15:85762885-85762907
Sequence CGAGCTCATTAATCCACTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 42}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130651150_1130651162 28 Left 1130651150 15:85762885-85762907 CCCACAGTGGATTAATGAGCTCG 0: 1
1: 0
2: 0
3: 5
4: 42
Right 1130651162 15:85762936-85762958 TGCCCTGCACCCCAGTGGCTAGG 0: 1
1: 1
2: 1
3: 25
4: 273
1130651150_1130651159 23 Left 1130651150 15:85762885-85762907 CCCACAGTGGATTAATGAGCTCG 0: 1
1: 0
2: 0
3: 5
4: 42
Right 1130651159 15:85762931-85762953 AACCCTGCCCTGCACCCCAGTGG 0: 1
1: 0
2: 3
3: 39
4: 342
1130651150_1130651153 -5 Left 1130651150 15:85762885-85762907 CCCACAGTGGATTAATGAGCTCG 0: 1
1: 0
2: 0
3: 5
4: 42
Right 1130651153 15:85762903-85762925 GCTCGGCCTTTCCCAGAGCCAGG 0: 1
1: 0
2: 2
3: 22
4: 240
1130651150_1130651154 0 Left 1130651150 15:85762885-85762907 CCCACAGTGGATTAATGAGCTCG 0: 1
1: 0
2: 0
3: 5
4: 42
Right 1130651154 15:85762908-85762930 GCCTTTCCCAGAGCCAGGACTGG 0: 1
1: 1
2: 4
3: 18
4: 286

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130651150 Original CRISPR CGAGCTCATTAATCCACTGT GGG (reversed) Intronic