ID: 1130651459

View in Genome Browser
Species Human (GRCh38)
Location 15:85764320-85764342
Sequence CACGGGATTGGGGTGGCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 634
Summary {0: 1, 1: 0, 2: 1, 3: 40, 4: 592}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130651451_1130651459 4 Left 1130651451 15:85764293-85764315 CCAGGGTCATAGTGAGGGGACAG 0: 1
1: 0
2: 0
3: 18
4: 189
Right 1130651459 15:85764320-85764342 CACGGGATTGGGGTGGCCTCAGG 0: 1
1: 0
2: 1
3: 40
4: 592
1130651450_1130651459 5 Left 1130651450 15:85764292-85764314 CCCAGGGTCATAGTGAGGGGACA 0: 1
1: 0
2: 1
3: 20
4: 154
Right 1130651459 15:85764320-85764342 CACGGGATTGGGGTGGCCTCAGG 0: 1
1: 0
2: 1
3: 40
4: 592

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130651459 Original CRISPR CACGGGATTGGGGTGGCCTC AGG Intronic
900266874 1:1761853-1761875 CATGGGATGGGGGAGTCCTCGGG - Intronic
900823215 1:4905978-4906000 CGCAGGACTGGGGAGGCCTCAGG + Intergenic
901059022 1:6463131-6463153 CAAGGGACGGGGGTGGCCTGAGG + Exonic
901252355 1:7790259-7790281 CACATGACTGGGGAGGCCTCAGG + Intronic
901923670 1:12552823-12552845 CCTGGCCTTGGGGTGGCCTCCGG + Intergenic
902222369 1:14975035-14975057 CACATCAGTGGGGTGGCCTCTGG + Intronic
903839841 1:26230991-26231013 CACAGGGCTGGGGAGGCCTCAGG - Intergenic
904312366 1:29637142-29637164 CAAGGAATGTGGGTGGCCTCTGG - Intergenic
904337477 1:29807479-29807501 CACGTGGCTGGGGAGGCCTCAGG - Intergenic
904856625 1:33502683-33502705 CACAGGGCTGGGGAGGCCTCAGG - Intergenic
904863314 1:33556906-33556928 CACAGGGCTGGGGAGGCCTCAGG - Intronic
904923263 1:34025502-34025524 TAGGGGATCGGGGTGGCCACAGG + Intronic
905371394 1:37484401-37484423 CAGGGCTTTGGGCTGGCCTCTGG + Intergenic
905951095 1:41951645-41951667 CACGTGGCTGGGGAGGCCTCAGG + Intronic
906664457 1:47609486-47609508 CACATGGTTGGGGAGGCCTCAGG + Intergenic
907585023 1:55609325-55609347 CACAGGGCTGGGGAGGCCTCAGG + Intergenic
907597819 1:55735877-55735899 CACAGGGCTGGGGAGGCCTCAGG + Intergenic
907683603 1:56588150-56588172 CACAGGGCTGGGGAGGCCTCAGG + Intronic
907733814 1:57092562-57092584 CACATGATTGGGGAGGCCTCAGG - Intronic
908328384 1:63045593-63045615 CACAGGGCTGGGGAGGCCTCAGG - Intergenic
908932397 1:69332580-69332602 CACATGGTTGGGGAGGCCTCAGG + Intergenic
909133648 1:71769673-71769695 CACAGGACTGGGGAGGCCTCAGG - Intronic
909990073 1:82212596-82212618 CACTGGATTGGGATGGACTATGG - Intergenic
910013636 1:82495509-82495531 AACGTGGTTGGGGAGGCCTCGGG + Intergenic
911610092 1:99951067-99951089 CACAGGGCTGGGGAGGCCTCAGG + Intergenic
911841919 1:102693607-102693629 CACAGGAGTGGGGAGGCCTCAGG - Intergenic
912205932 1:107509756-107509778 CACAGGGTTAGGGAGGCCTCAGG - Intergenic
912301733 1:108524774-108524796 CACATGACTGGGGAGGCCTCAGG + Intergenic
912708578 1:111933205-111933227 CACATGACTGGGGAGGCCTCAGG - Intronic
913034692 1:114952498-114952520 CACAGGGCTGGGGAGGCCTCAGG + Intronic
914196118 1:145448886-145448908 CACTGGGGTGGGGTGGCCCCTGG - Intergenic
914356948 1:146894706-146894728 CACAGGGCTGGGGAGGCCTCAGG + Intergenic
915451593 1:156009178-156009200 CAGGGGATAGGGGTGGTGTCAGG + Exonic
915875987 1:159612660-159612682 CCCGGGATGGGAGGGGCCTCTGG - Intergenic
915897441 1:159823114-159823136 CTAGGGAGTGGGGAGGCCTCTGG - Intergenic
916851389 1:168707836-168707858 CACAGGGCTGGGGAGGCCTCAGG - Intronic
916924024 1:169498686-169498708 CACGTGGCTGGGGAGGCCTCAGG + Intergenic
916993110 1:170266182-170266204 CACAGGGCTGGGGAGGCCTCAGG + Intergenic
917690728 1:177465706-177465728 CACAGGGCTGGGGAGGCCTCAGG + Intergenic
918186766 1:182134514-182134536 CACAGGGCTGGGGAGGCCTCAGG - Intergenic
918230740 1:182528858-182528880 CACATGACTGGGGAGGCCTCAGG + Intronic
918773457 1:188595158-188595180 CACAGGGCTGGGGAGGCCTCAGG - Intergenic
919366775 1:196670612-196670634 CACATGGTTGGGGAGGCCTCAGG - Intronic
920325131 1:205157055-205157077 CACAGGGTTGGAGAGGCCTCAGG - Intronic
920741040 1:208581672-208581694 CATGGGATTTGGGGGGCCTTGGG - Intergenic
920800394 1:209182389-209182411 CACAGGGTTGGGGATGCCTCAGG - Intergenic
920803115 1:209207772-209207794 CCAGGGCTTGGGGTGGGCTCGGG + Intergenic
921300270 1:213745256-213745278 GAAGGGATGGGGGAGGCCTCAGG + Intergenic
921404060 1:214759531-214759553 CACATGGTTGGGGAGGCCTCAGG - Intergenic
921662202 1:217817471-217817493 CACAGGGCTGGGGAGGCCTCAGG - Intronic
923128808 1:231057120-231057142 CACATGGTTGGGGAGGCCTCAGG + Intergenic
923302111 1:232650837-232650859 CAGGGGATTGGGGTGGGCTCTGG + Intergenic
923427919 1:233890613-233890635 CACAGGGCTGGGGAGGCCTCAGG - Intergenic
923808833 1:237289426-237289448 CACAGGGCTGGGGAGGCCTCAGG + Intronic
924020515 1:239776756-239776778 CACAGGGCTGGGGAGGCCTCAGG + Intronic
924463315 1:244278830-244278852 CACAGGGCTGGGGAGGCCTCAGG - Intergenic
1062897431 10:1114975-1114997 TACGGGATTGGGGTGTGCTGAGG - Intronic
1063180178 10:3591041-3591063 CAAGGGATTGAGGCGGCCTCTGG + Intergenic
1063260813 10:4386980-4387002 CACATGGTTGGGGAGGCCTCGGG + Intergenic
1063280777 10:4627429-4627451 CACAGGGTTAGGGAGGCCTCAGG + Intergenic
1064220495 10:13436596-13436618 CACGTGGCTGGGGAGGCCTCAGG - Intergenic
1064641594 10:17420829-17420851 CACCTGAGTGGGGAGGCCTCAGG + Intronic
1064852560 10:19725425-19725447 CACAGGCCTGGGGAGGCCTCAGG - Intronic
1065642169 10:27794392-27794414 CATGGGGCTGGGGAGGCCTCAGG - Intergenic
1065751245 10:28889963-28889985 CACGTGGCTGGGGAGGCCTCAGG + Intergenic
1066439768 10:35427350-35427372 CACAGGAGTGGGATGGACTCAGG - Intronic
1067524756 10:47031581-47031603 CAAGGGAGTGGGCTGGGCTCAGG + Intergenic
1067819037 10:49510516-49510538 CACGGGATTGGGAGGGCCCTTGG - Intronic
1068915640 10:62428533-62428555 CACAGGGCTGGGGAGGCCTCAGG - Intronic
1070230254 10:74558595-74558617 CACATGACTGGGGAGGCCTCAGG - Intronic
1070472935 10:76801793-76801815 CAAGGGATGCAGGTGGCCTCTGG + Intergenic
1072052090 10:91714830-91714852 CACGTGCCTGGGGAGGCCTCAGG - Intergenic
1072192780 10:93089787-93089809 CCTGGTAGTGGGGTGGCCTCAGG + Intergenic
1072634340 10:97167912-97167934 CACAGGGCTGGGGAGGCCTCAGG - Intronic
1072808953 10:98445132-98445154 ATCAGGATGGGGGTGGCCTCAGG + Intronic
1073093447 10:100965197-100965219 CAGGGGACTGGGGTGGGCTGAGG - Intergenic
1074037333 10:109753577-109753599 CAGGGGAGTGGAGTGGACTCTGG + Intergenic
1074806164 10:117055014-117055036 CACATGGTTGGGGAGGCCTCAGG + Intronic
1075352253 10:121734312-121734334 AACAGGATTGGGATGGCCGCTGG + Intergenic
1075607215 10:123820712-123820734 CAGGGAATGTGGGTGGCCTCTGG - Intronic
1076055433 10:127368489-127368511 CTCTGGATTGGGGTGGGCACAGG - Intronic
1076210922 10:128644264-128644286 CACAGGGCTGGGGAGGCCTCAGG - Intergenic
1076820569 10:132936769-132936791 CCAGGAATTGGGGTGGCCTTCGG + Intronic
1077009647 11:374496-374518 CAGGGGTTTGGGGTGGTCTGTGG + Intronic
1077460654 11:2707732-2707754 CAAGGGATTGGGCAGGCCTTAGG + Intronic
1077667891 11:4131108-4131130 CGCAGGGTTGGGGAGGCCTCAGG + Intronic
1077730212 11:4722565-4722587 CACGGGCAAGGGGTGTCCTCAGG + Intronic
1077979406 11:7285255-7285277 CACAGGGCTGGGGAGGCCTCAGG + Intronic
1078686465 11:13536848-13536870 CACAGGGCTGGGGAGGCCTCAGG - Intergenic
1078857361 11:15217136-15217158 CACAGGACTGGGGAGGTCTCAGG + Intronic
1079325376 11:19486639-19486661 CACATGTTTGGGGAGGCCTCAGG - Intronic
1079567784 11:21904063-21904085 CACATGACTGGGGAGGCCTCAGG + Intergenic
1080205485 11:29724459-29724481 CACATGATTGGGGAGGCCTCAGG + Intergenic
1080293692 11:30700805-30700827 CACAGGGCTGGGGAGGCCTCAGG + Intergenic
1080627406 11:34042993-34043015 CACAGGCTGGGGGAGGCCTCAGG + Intergenic
1081315405 11:41624531-41624553 CACGTGGCTGGGGAGGCCTCAGG + Intergenic
1082300042 11:50494122-50494144 CACGGGATTGGTGTGTCATCAGG + Intergenic
1082865750 11:57898715-57898737 CACGTGGCTGGGGAGGCCTCAGG - Intergenic
1082887532 11:58103129-58103151 CACAGGGCTGGGGAGGCCTCAGG + Intronic
1083408103 11:62472465-62472487 CTTGGGATTGGGGTGGTTTCTGG - Intronic
1083511073 11:63209889-63209911 CATGGGTTAGGGGTGGCCTCTGG - Intronic
1084195439 11:67521864-67521886 CACAGGGTTGGGGGGGCATCGGG - Intronic
1085639184 11:78181023-78181045 CACAGGACTAGGGAGGCCTCAGG - Intronic
1086032736 11:82379797-82379819 CACATGACTGGGGAGGCCTCAGG + Intergenic
1090098705 11:123771256-123771278 CACATGACTGGGGAGGCCTCAGG + Intergenic
1090257963 11:125299042-125299064 CTCGGGTTTGGGGAGGCCTCTGG + Intronic
1092280070 12:7091897-7091919 GAGGGGAGTGTGGTGGCCTCTGG - Intronic
1093280197 12:17184829-17184851 CACAGGGCTGGGGAGGCCTCAGG - Intergenic
1093570858 12:20664150-20664172 CACAGGGCTGGGGAGGCCTCAGG - Intronic
1093646154 12:21587587-21587609 CACAGGGCTGGGGAGGCCTCGGG - Intronic
1093771190 12:23020604-23020626 CACGCAACTGGGGAGGCCTCAGG - Intergenic
1095367243 12:41422508-41422530 CACATGACTGGGGAGGCCTCAGG + Intronic
1095627485 12:44333648-44333670 CACAGGGCTGGGGAGGCCTCAGG - Intronic
1096387962 12:51207440-51207462 CACCGGACTGGGGAGGCCCCAGG - Intronic
1096471728 12:51882130-51882152 CGCAGGGTTGGGGAGGCCTCAGG + Intergenic
1096969064 12:55651001-55651023 CACGTGGCTGGGGAGGCCTCAGG - Intergenic
1097400961 12:59127213-59127235 CACAGGGCTGGGGAGGCCTCAGG + Intergenic
1097503797 12:60438922-60438944 CACAGGTCTGGGGAGGCCTCAGG - Intergenic
1097575529 12:61388561-61388583 CACAGGACTGGGGAGGCCTCAGG + Intergenic
1098139730 12:67439138-67439160 CACATGGTTGGGGAGGCCTCAGG - Intergenic
1098310939 12:69148377-69148399 CACATGACTGGGGAGGCCTCAGG - Intergenic
1098830946 12:75361596-75361618 CACGTGACTGGGGAGGCCTCAGG + Intronic
1099214752 12:79839786-79839808 CACAGGGCTGGGGAGGCCTCAGG - Intronic
1099217253 12:79867917-79867939 CACAGGGCTGGGGAGGCCTCAGG - Intronic
1099520487 12:83654620-83654642 CACAGGGCTGGGGAGGCCTCAGG + Intergenic
1099732633 12:86525335-86525357 CATGTGACTGGGGAGGCCTCAGG - Intronic
1099819562 12:87693126-87693148 CACAGGGTTGGGGAGGCCTCAGG + Intergenic
1099867948 12:88307908-88307930 CACGTGGTTGGGGAGACCTCAGG + Intergenic
1100230173 12:92599350-92599372 CACATGGCTGGGGTGGCCTCAGG + Intergenic
1100279730 12:93106966-93106988 CACGTGGCTGGGGAGGCCTCAGG + Intergenic
1100780740 12:98023493-98023515 CACAGGGCTGGGGAGGCCTCAGG + Intergenic
1100902937 12:99263814-99263836 CACGTGACTAGGGAGGCCTCAGG - Intronic
1101032759 12:100676468-100676490 CACAGGGCTGGGGAGGCCTCAGG - Intergenic
1101260264 12:103022070-103022092 CACAGGGCTGGGGAGGCCTCAGG - Intergenic
1101535566 12:105613215-105613237 CACGTGGCTGGGGAGGCCTCAGG - Intergenic
1101658707 12:106747274-106747296 CAGGGGATGGGGGATGCCTCTGG + Intronic
1102010097 12:109612901-109612923 CAAGGGAATGGGGTGAGCTCAGG + Intergenic
1102660571 12:114524011-114524033 CACTGGGCTGGGGAGGCCTCAGG + Intergenic
1102826386 12:115950903-115950925 CACGTGGCTGGGGAGGCCTCAGG + Intergenic
1103264405 12:119616934-119616956 CACAGGGCTGGGGAGGCCTCAGG - Intronic
1103527511 12:121578357-121578379 AACGGGATTGGGAAGGCTTCGGG + Intronic
1103739898 12:123084057-123084079 CACAGGGTTGGGGTGACCCCGGG + Intronic
1104386009 12:128352214-128352236 CACGGGGCTGGGGAGGCCTCAGG + Intronic
1104495447 12:129232738-129232760 CACGTGGCTGGGGAGGCCTCAGG + Intronic
1104599111 12:130140379-130140401 CAGGGGACTGGGGTGGCGTGCGG + Intergenic
1105069773 12:133227438-133227460 CAGGGGCTTGGGGTGGCCCTGGG - Intronic
1105947397 13:25201706-25201728 CACTTGACTGGGGTGGCATCTGG + Intergenic
1106093213 13:26617988-26618010 CACGTGGCTGGGGAGGCCTCAGG - Intronic
1107342454 13:39422847-39422869 CATGGGACTGGGGAGGCCTCAGG + Intronic
1108281030 13:48862077-48862099 CATGTGGTTGGGGAGGCCTCAGG + Intergenic
1108920561 13:55668685-55668707 CACGTGGTTGGGGAGGCCTCCGG + Intergenic
1109852731 13:68088553-68088575 CACGTGGCTGGGGAGGCCTCAGG + Intergenic
1109955330 13:69558081-69558103 CACATGACTGGGGAGGCCTCAGG - Intergenic
1110149895 13:72238770-72238792 CACAGGGCTGGGGAGGCCTCAGG + Intergenic
1110169661 13:72485426-72485448 CACATGGGTGGGGTGGCCTCAGG - Intergenic
1110461850 13:75753753-75753775 CACAGGACTGGAGAGGCCTCAGG - Intronic
1110552040 13:76821273-76821295 CATAGGACTGGGGAGGCCTCAGG + Intergenic
1111087346 13:83393680-83393702 CACAGGGTTTGGGAGGCCTCAGG + Intergenic
1111271364 13:85891672-85891694 CACATGACTGGGGAGGCCTCAGG - Intergenic
1111421788 13:88019956-88019978 CACAGGGTTGGGGAGACCTCGGG - Intergenic
1111635527 13:90898510-90898532 CACATGACTGGGGAGGCCTCAGG - Intergenic
1111855059 13:93626888-93626910 AACGTGACTGGGGAGGCCTCAGG + Intronic
1112108504 13:96268286-96268308 CACAGGGCTGGGGAGGCCTCAGG + Intronic
1112238437 13:97657408-97657430 CACATGACTGGGGAGGCCTCAGG + Intergenic
1112257869 13:97851206-97851228 CACAGGGCTGGGGAGGCCTCAGG + Intergenic
1112697071 13:101961805-101961827 CACAGGACTGGGGAGGCCTCAGG - Intronic
1112700753 13:102004919-102004941 CACAGGACTGGGGAGGCCTCAGG - Intronic
1112857367 13:103787693-103787715 CACGTGGCTGGGGAGGCCTCAGG + Intergenic
1113139189 13:107128123-107128145 CACATGGTTGGGGAGGCCTCAGG + Intergenic
1113513229 13:110872225-110872247 CACGGAGCTGGGGTGGCCTTAGG + Intergenic
1114670863 14:24410218-24410240 CACGGGCGTGGGGTGGGCTGGGG + Intronic
1114766176 14:25373221-25373243 CACATGGCTGGGGTGGCCTCAGG + Intergenic
1115249226 14:31328928-31328950 CACATGATTGGGGAAGCCTCAGG + Intronic
1116339923 14:43709309-43709331 CACAGGGCTGGGGAGGCCTCTGG - Intergenic
1116364224 14:44039930-44039952 CACATGACTGGGGAGGCCTCAGG - Intergenic
1116378258 14:44231527-44231549 CACGTGGCTGGGGAGGCCTCAGG + Intergenic
1116887533 14:50235672-50235694 CACAGGGCTGGGGAGGCCTCAGG + Intergenic
1117001212 14:51373563-51373585 CACAGGGCTGGGGAGGCCTCAGG + Intergenic
1117173782 14:53128149-53128171 CACGTGGCTGGGGAGGCCTCAGG - Intronic
1118719390 14:68583571-68583593 CACTGGAATGTGGTGGCCTTGGG + Intronic
1118941251 14:70340304-70340326 CACAAGACTGGGGAGGCCTCAGG - Intronic
1119018940 14:71089492-71089514 CACAGGGGTGGGGAGGCCTCAGG + Intronic
1119962990 14:78881135-78881157 CACATGACTGGGGAGGCCTCAGG - Intronic
1120175845 14:81292636-81292658 TGCGGGGTTGGGGAGGCCTCAGG - Intronic
1120244841 14:81994637-81994659 CACGTGGCTGGGGAGGCCTCAGG + Intergenic
1120247255 14:82021964-82021986 CACATGGTTGGGGAGGCCTCGGG + Intergenic
1120425827 14:84346950-84346972 CACAGGGCTGGGGAGGCCTCAGG + Intergenic
1120654033 14:87168456-87168478 CACGTGGCTGGGGAGGCCTCAGG + Intergenic
1121207331 14:92180364-92180386 CACAGGGCTGGGGAGGCCTCAGG - Intergenic
1121813134 14:96908913-96908935 CACAGGGCTGGGGAGGCCTCAGG + Intronic
1122475925 14:102008961-102008983 CACGGGATGAGCGTGTCCTCTGG + Intronic
1122695989 14:103552344-103552366 CAGGGGGATGAGGTGGCCTCAGG + Intergenic
1122801914 14:104235266-104235288 CACAGGGCTGGGGAGGCCTCAGG - Intergenic
1122967290 14:105137312-105137334 CACAGGTTTGGGGTGGCCCAAGG - Intergenic
1123645990 15:22437766-22437788 CTCGGGATTGGTATGGACTCTGG + Intergenic
1123700830 15:22913788-22913810 CACAGCATTGGGGTGGCGTGAGG - Intronic
1123732317 15:23157578-23157600 CTCGGGATTGGTATGGACTCTGG - Intergenic
1124254334 15:28128876-28128898 CTGGGGAATGGGGTGGCCCCTGG - Intronic
1124550011 15:30671746-30671768 CACGTGGCTGGGGAGGCCTCAGG + Intronic
1124608977 15:31194567-31194589 CTCGGCTTTGGGGAGGCCTCAGG + Intergenic
1124637416 15:31373898-31373920 GGGGGGATTGGGGTGGACTCAGG + Exonic
1124910666 15:33916851-33916873 CATAGGGTTGGGGAGGCCTCAGG + Intronic
1125116627 15:36101100-36101122 CACAGGGCTGGGGAGGCCTCAGG + Intergenic
1125883958 15:43214707-43214729 CTCGGGAATGAGGTGGCCTGAGG - Intronic
1126309814 15:47302735-47302757 AAAGGGATGGGGGTAGCCTCTGG + Intronic
1126939964 15:53756327-53756349 CACGTGGCTGGGGAGGCCTCAGG - Intronic
1127144512 15:56010748-56010770 CACAGGACTGGGGAGGCCTCAGG - Intergenic
1128264567 15:66254828-66254850 CACGGGATAGGAGTGGCGGCAGG + Intergenic
1129911916 15:79234884-79234906 CACAGGGCTGGGGAGGCCTCAGG - Intergenic
1130651459 15:85764320-85764342 CACGGGATTGGGGTGGCCTCAGG + Intronic
1131066773 15:89439638-89439660 CAGGTGAGTGGGGTGCCCTCAGG - Intergenic
1132584075 16:698503-698525 GAAGGGTCTGGGGTGGCCTCTGG + Intronic
1132595492 16:747219-747241 CACAGGGCTGGGGAGGCCTCAGG - Intronic
1132612412 16:824005-824027 CCCGGGACTGGGGGGGTCTCAGG - Intergenic
1134686464 16:16162112-16162134 CACGTGGCTGGGGAGGCCTCAGG - Intronic
1137331737 16:47504829-47504851 CAGGGGACTGGAGAGGCCTCGGG - Intronic
1137460478 16:48656771-48656793 CACAGGACTGGGGAGGCCTCAGG - Intergenic
1137812772 16:51368515-51368537 CACATGGTTGGGGAGGCCTCAGG - Intergenic
1137845815 16:51687047-51687069 CAAGGAATGGAGGTGGCCTCTGG - Intergenic
1138073619 16:54018777-54018799 CACAGGACTTGGGAGGCCTCAGG - Intronic
1138968004 16:62109684-62109706 CACATGATTGGGAAGGCCTCAGG - Intergenic
1139309447 16:66016161-66016183 CCAAGGAATGGGGTGGCCTCTGG - Intergenic
1139372831 16:66479361-66479383 CAGAGGGTTGGGTTGGCCTCAGG + Intronic
1140873305 16:79126571-79126593 CACATGACTGGGGAGGCCTCAGG - Intronic
1141273209 16:82559303-82559325 CACAGGACTAGGGAGGCCTCAGG - Intergenic
1141597547 16:85106591-85106613 CAAGGGATGTGCGTGGCCTCTGG + Intronic
1141763439 16:86043873-86043895 CAAGGAATGCGGGTGGCCTCTGG + Intergenic
1142174683 16:88639671-88639693 CACGGGCTTGGGGTGCAGTCGGG - Intronic
1142571011 17:874237-874259 CACAGGGCTGGGGAGGCCTCGGG - Intronic
1143171671 17:4933952-4933974 GTCGGGATTGGGGTGGGCTCCGG - Exonic
1143832742 17:9665363-9665385 CACATGACTGGGGAGGCCTCAGG + Intronic
1143926601 17:10376710-10376732 CACAGGACTGGGGTGGGGTCGGG + Intergenic
1144399533 17:14883127-14883149 CACAGGGCTGGGGAGGCCTCAGG + Intergenic
1146449450 17:32960963-32960985 CATGGGATGGGGCTGGCCTGTGG - Intergenic
1146454181 17:32996606-32996628 CATGGGTTGGGGCTGGCCTCAGG - Intronic
1146461023 17:33046206-33046228 CAGGGGATTGGGGTGGGGTCAGG + Intronic
1150474763 17:65466573-65466595 CACAGGGCTGGGGAGGCCTCAGG + Intergenic
1150590332 17:66556798-66556820 CACAGGCCTGGGGAGGCCTCAGG - Intronic
1150962750 17:69932712-69932734 CACATGACTGGGGAGGCCTCAGG - Intergenic
1151470441 17:74314480-74314502 CTCGGCCTTGGGGTGGGCTCAGG - Intronic
1152640270 17:81446429-81446451 CCGGGGCTGGGGGTGGCCTCAGG - Intronic
1155446171 18:25915194-25915216 CACAGGGCTGGGGAGGCCTCAGG + Intergenic
1155523403 18:26691694-26691716 CACAGGGCTGGGGAGGCCTCAGG - Intergenic
1155957436 18:31965640-31965662 CACAGGGCTGGGGAGGCCTCAGG + Intergenic
1155968172 18:32055455-32055477 CACATGGCTGGGGTGGCCTCAGG + Intronic
1156078311 18:33306989-33307011 CACAGGGCTGGGGAGGCCTCAGG - Intronic
1156572828 18:38278743-38278765 CACATGGTTGGGGAGGCCTCAGG + Intergenic
1157077414 18:44480484-44480506 CACATGACTGGGGAGGCCTCAGG - Intergenic
1157781181 18:50440579-50440601 CACATGACTGGGGAGGCCTCAGG - Intergenic
1159304739 18:66626221-66626243 CACAGGGCTGGGGAGGCCTCAGG - Intergenic
1159424659 18:68269658-68269680 CACGTGGCTGGGGTGGCCTCAGG - Intergenic
1159468216 18:68813273-68813295 CACATGACTGGGGAGGCCTCAGG - Intronic
1159822304 18:73161273-73161295 CACATGGTTGGGGAGGCCTCAGG + Exonic
1159824360 18:73188462-73188484 CCCGTGGTTGGGGAGGCCTCAGG - Intronic
1160159779 18:76462180-76462202 CACTGTGATGGGGTGGCCTCTGG - Intronic
1160258100 18:77264683-77264705 CACAGGGCTGGGGAGGCCTCAGG + Intronic
1160258378 18:77266628-77266650 CACAGGGATGGGGAGGCCTCAGG + Intronic
1160435208 18:78846478-78846500 CACAGGACTGGGGAGGCTTCAGG - Intergenic
1160656967 19:277958-277980 CACGGCAGTGGTGTGGCCTGTGG - Intergenic
1160747216 19:717750-717772 GCCGGGATTGGGGGGACCTCTGG + Intronic
1160960877 19:1720288-1720310 CAAGGGCTTGGGTTGGCCACAGG - Intergenic
1160962458 19:1729666-1729688 CACGGGGTCGGGGTGGTCGCAGG - Intergenic
1161121094 19:2527281-2527303 CACAGCATTGGGCTGACCTCAGG - Intronic
1161458502 19:4382104-4382126 CAATGGATGTGGGTGGCCTCTGG - Intronic
1161612049 19:5248531-5248553 CACGGGTTTGGGGCGGCCACAGG + Intronic
1162087371 19:8256843-8256865 CAGGGGGTTGGTGTGGCCTCTGG - Intronic
1162254432 19:9476725-9476747 CACATGACTGGGGAGGCCTCAGG - Intronic
1162480265 19:10923471-10923493 TACGGGTCTGGGGTGGCCACAGG - Intronic
1162588853 19:11577786-11577808 CACGGGATTGGGGTGGGGGTGGG + Intronic
1164011214 19:21204835-21204857 CATGGGTTAGGGATGGCCTCTGG + Intergenic
1164015809 19:21255126-21255148 CATGGGTTAGGGGTGGCCTCTGG - Intronic
1165401853 19:35606063-35606085 CGCAGGGTTGGGGAGGCCTCAGG + Intergenic
1165945217 19:39437711-39437733 CCCAGGATTGGGTTGTCCTCTGG + Intronic
1166365782 19:42277891-42277913 CAAGGGCTTAGGGAGGCCTCTGG - Intronic
1166750035 19:45160203-45160225 CACAGGCTTGGCGTAGCCTCTGG + Intronic
1167491832 19:49797193-49797215 CACAGGGTTGGTGTGTCCTCAGG - Intronic
925326059 2:3022969-3022991 CAAGGCATTGGGGTGGCATTGGG + Intergenic
925942930 2:8837414-8837436 CGCGGGATTGGGGAGGAGTCGGG - Intronic
928581230 2:32709669-32709691 CACTGGATATGGGCGGCCTCAGG + Intronic
929164286 2:38865447-38865469 CACAGGGCTGGGGTGGCCTCAGG - Intronic
929699234 2:44147523-44147545 CACGTGGCTGGGGAGGCCTCAGG - Intergenic
930174598 2:48288817-48288839 CACATGGTTGGGGAGGCCTCAGG - Intergenic
930427975 2:51235113-51235135 CACAGGGCTGGGGAGGCCTCAGG + Intergenic
931130872 2:59334051-59334073 CACATGACTGGGGAGGCCTCAGG - Intergenic
932143461 2:69299027-69299049 CAAGGAACTGAGGTGGCCTCTGG + Intergenic
932221445 2:70002627-70002649 CACAGGATTGGCTTTGCCTCTGG - Intergenic
932463741 2:71899648-71899670 CACATGGTTGGGGAGGCCTCAGG - Intergenic
932648643 2:73531745-73531767 CACATGGTTGGGGAGGCCTCAGG + Intronic
933060285 2:77727875-77727897 CACATGGTTGGGGAGGCCTCAGG - Intergenic
933292294 2:80451416-80451438 CACAGGGCTGGGGAGGCCTCAGG - Intronic
936588537 2:113780611-113780633 CACGTGACTGGGGAGGACTCAGG + Intergenic
937212573 2:120285098-120285120 CACAGGGCTGGGGAGGCCTCAGG + Intronic
939098372 2:137863661-137863683 CACGTGGCTGGGGAGGCCTCAGG - Intergenic
939826493 2:147022412-147022434 CACAGGGATGGGGAGGCCTCAGG + Intergenic
940499549 2:154477128-154477150 CACATGACTGGGGAGGCCTCAGG - Intergenic
940728301 2:157361018-157361040 CACGTGACTGGGGAAGCCTCAGG - Intergenic
940856229 2:158730619-158730641 CAGGGGTTTGGGGTTGCCCCTGG + Intergenic
941992081 2:171567445-171567467 CACACGACTGGGGAGGCCTCAGG + Intergenic
942144048 2:173008219-173008241 CACAGGGCTGGGGAGGCCTCAGG - Intronic
944472707 2:200072112-200072134 CACAGGACTGGGGAGGCCTCAGG + Intergenic
944475129 2:200095764-200095786 CACAGGGCTGGGGAGGCCTCAGG - Intergenic
944721748 2:202429697-202429719 CACATGACTGGGGAGGCCTCAGG + Intronic
945149889 2:206779446-206779468 CACATGACTGGGGAGGCCTCAGG + Intronic
945730392 2:213525228-213525250 CACAGGGCTGGGGAGGCCTCAGG - Intronic
945745244 2:213712968-213712990 CACGTGGTTGGGGAGGCATCAGG + Intronic
945882589 2:215341906-215341928 CACACGGTTGGGGAGGCCTCAGG + Intronic
946120433 2:217508132-217508154 CACAGGGCTGGGGAGGCCTCAGG + Intronic
946191331 2:218009622-218009644 CACGGGAATGGGGTGGCTGGGGG - Intergenic
946225696 2:218263066-218263088 CAGGGGGCTGGAGTGGCCTCAGG - Exonic
947527670 2:230889145-230889167 CACGTGGCTGGGGAGGCCTCTGG + Intergenic
947903244 2:233740143-233740165 CACATGACTGGGGAGGCCTCAGG - Intronic
948878777 2:240844925-240844947 CACAGGGCTGGGGAGGCCTCAGG - Intergenic
1169141694 20:3230388-3230410 CAAGGGGCTGGGGTGGGCTCAGG - Intronic
1169446121 20:5672376-5672398 CACATGACTGGGGAGGCCTCAGG + Intergenic
1169770076 20:9190457-9190479 CATATGATTGGGGAGGCCTCAGG - Intronic
1169864840 20:10188706-10188728 CTCTGGGTTGGGATGGCCTCTGG - Intergenic
1170065119 20:12302783-12302805 CACATGGTTGGGGAGGCCTCAGG + Intergenic
1171185290 20:23120417-23120439 CAAGGGACTGGGGTGGTCTGGGG - Intergenic
1173466040 20:43282185-43282207 CAGGGGATGGGGGTGGCAACAGG + Intergenic
1173971028 20:47152472-47152494 CAAGGGATGGGGCTGCCCTCAGG - Intronic
1174685752 20:52453289-52453311 CACAGGGCTGGGGAGGCCTCAGG - Intergenic
1174715902 20:52758408-52758430 CACAGGGCTGGGGAGGCCTCAGG - Intergenic
1175096169 20:56543202-56543224 CACAGGGCTGGGGAGGCCTCAGG - Intergenic
1175298451 20:57925781-57925803 CACAGGGCTGGGGAGGCCTCAGG - Intergenic
1175692432 20:61075291-61075313 CACAGCATTGGGTTTGCCTCAGG - Intergenic
1175745476 20:61454000-61454022 CACAGGGCTGGGGAGGCCTCAGG - Intronic
1175861572 20:62153053-62153075 CACAGGGCTGGGGAGGCCTCAGG + Intronic
1176255758 20:64152015-64152037 CACGGGCTTTGTGTGGTCTCAGG + Intronic
1177022242 21:15876468-15876490 CACATGGTTGGGGAGGCCTCAGG + Intronic
1177305871 21:19315745-19315767 CACAGGGCTGGGGAGGCCTCAGG + Intergenic
1177854089 21:26382565-26382587 CACAGGACTGGGGAGACCTCAGG - Intergenic
1178392418 21:32209862-32209884 CACAGGGTTGCGGAGGCCTCAGG - Intergenic
1178883447 21:36466372-36466394 CGCAGGACTGGGGAGGCCTCAGG + Intronic
1179725619 21:43339877-43339899 CAGGGAATGCGGGTGGCCTCGGG + Intergenic
1180814136 22:18779097-18779119 CACTGGACTGGGGTACCCTCTGG + Intergenic
1181030101 22:20145491-20145513 CACCAGGCTGGGGTGGCCTCGGG - Intronic
1181125134 22:20697706-20697728 CACTGGCTTGGGGCGCCCTCAGG + Intergenic
1181129480 22:20722107-20722129 CACGTGGCTGGGGAGGCCTCAGG - Intronic
1183847278 22:40552664-40552686 CACAGGGCTGGGGAGGCCTCAGG - Intronic
1184113030 22:42406268-42406290 GCCGGGATCAGGGTGGCCTCAGG - Intronic
1185114670 22:48925314-48925336 CACAGGGATGGGGAGGCCTCAGG + Intergenic
1185342812 22:50299265-50299287 CAAAGGATTGGGGTGGACACAGG + Intronic
1203264234 22_KI270734v1_random:4784-4806 CACTGGACTGGGGTACCCTCTGG + Intergenic
949292609 3:2483765-2483787 CACATGGTTGGGGAGGCCTCAGG - Intronic
949367908 3:3302843-3302865 CACATGGCTGGGGTGGCCTCAGG - Intergenic
949401497 3:3669542-3669564 CACATGACTGGGGAGGCCTCAGG + Intergenic
949405572 3:3710729-3710751 CACATGACTGGGGAGGCCTCAGG - Intronic
949510201 3:4760698-4760720 CAAGGGATGTGGGTGGCCTCTGG - Intronic
950452198 3:13071845-13071867 CGGGGGATGGCGGTGGCCTCTGG - Intronic
950452207 3:13071870-13071892 CGGGGGATGGCGGTGGCCTCTGG - Intronic
951969552 3:28428883-28428905 CACATGGTTGGGGAGGCCTCAGG - Intronic
953274388 3:41480751-41480773 CACAGGGCTGGGGAGGCCTCAGG + Intronic
953433275 3:42857061-42857083 CATGGGATTGGGGTGGACCATGG - Intronic
953980973 3:47412877-47412899 GATGGGATTGGGGTAGACTCTGG - Exonic
955586130 3:60480070-60480092 CACATGGTTGGGGAGGCCTCAGG + Intronic
955644842 3:61126401-61126423 CACATGGTTGGGGAGGCCTCAGG + Intronic
957464573 3:80570696-80570718 CACATGACTGGGGAGGCCTCAGG - Intergenic
958057030 3:88426757-88426779 CATAGGACTGGGGAGGCCTCAGG - Intergenic
959104382 3:102049695-102049717 CACGTGGCTGGGGAGGCCTCAGG - Intergenic
959788550 3:110329966-110329988 CACATGGCTGGGGTGGCCTCAGG - Intergenic
959804863 3:110539342-110539364 CACAGGGATGGGGAGGCCTCAGG - Intergenic
960671093 3:120156008-120156030 TACGTGGTTGGGGAGGCCTCAGG + Intergenic
962275474 3:134010311-134010333 CACATGACTGGGGAGGCCTCAGG + Intronic
962369084 3:134805827-134805849 CACTCGATTGGGTTGCCCTCTGG + Intronic
963671485 3:148257587-148257609 CACAGGGCTGGGGAGGCCTCAGG - Intergenic
964079990 3:152743001-152743023 CACATGACTGGGGAGGCCTCAGG + Intergenic
964992331 3:162829027-162829049 CATGGGGTGGTGGTGGCCTCTGG + Intergenic
965045278 3:163570426-163570448 TACGGGGCTGGGGAGGCCTCAGG - Intergenic
966463518 3:180203575-180203597 CAGGGGAGTGGGGTCCCCTCTGG - Intergenic
967152786 3:186664955-186664977 CAGGGAATTGGGGTGGCATGAGG + Intronic
968135135 3:196215407-196215429 CACAGGAGTGGGGAGTCCTCCGG + Intronic
969573423 4:8023234-8023256 CACGGGATTCGGGTTTCCCCGGG + Intronic
970301961 4:14691197-14691219 CACAGGGCTGGGGAGGCCTCAGG - Intergenic
970403961 4:15744304-15744326 CACGTGGTTGGGGAGGCCTCAGG + Intergenic
972142387 4:35976883-35976905 CACAGGTCTGGGGAGGCCTCAGG - Intronic
972827373 4:42775560-42775582 CACATGGTTGGGGAGGCCTCAGG + Intergenic
972998846 4:44919346-44919368 TACAGGACTGGGGAGGCCTCAGG - Intergenic
973346647 4:49063260-49063282 CACAGGGCTGGGGAGGCCTCAGG + Intergenic
973602984 4:52560364-52560386 CACATGGCTGGGGTGGCCTCAGG + Intergenic
974575848 4:63720320-63720342 CACAGGACTGGGAAGGCCTCAGG - Intergenic
974872377 4:67659537-67659559 CACATGACTGGGGAGGCCTCAGG - Intronic
974923313 4:68269276-68269298 CACATGACTGGGGAGGCCTCAGG + Intergenic
975093170 4:70426560-70426582 AACGTGGTTGGGGAGGCCTCAGG - Intergenic
975597271 4:76060804-76060826 CAAGGAATGTGGGTGGCCTCTGG + Intronic
976042575 4:80905620-80905642 CACAGGGTTGGGGAGGCCTCAGG + Intronic
977518997 4:98056926-98056948 CACATGGTTGGGGGGGCCTCCGG - Intronic
978068108 4:104431443-104431465 CACAGGACTGGGGAGGCCTCAGG + Intergenic
978162875 4:105570478-105570500 CACAGGGCTGGGGAGGCCTCAGG + Intronic
979362845 4:119784563-119784585 CACATGACTGGGGAGGCCTCAGG + Intergenic
979804908 4:124959624-124959646 CACATGGTTGGGGAGGCCTCAGG - Intergenic
980173694 4:129319978-129320000 CACTGGATTGAAATGGCCTCTGG + Intergenic
980242020 4:130190043-130190065 CACATGACTGGGGAGGCCTCAGG + Intergenic
980271908 4:130595019-130595041 CACATGGTTGGGGCGGCCTCAGG + Intergenic
980885457 4:138757810-138757832 CAAGGGAGTGGGGTGGGGTCAGG - Intergenic
981184088 4:141780596-141780618 CACATGGCTGGGGTGGCCTCAGG - Intergenic
981623384 4:146729686-146729708 TACAGGGTTGGGGAGGCCTCAGG + Intronic
982432399 4:155338026-155338048 CACATGACTGGGATGGCCTCAGG - Intergenic
982731888 4:158964755-158964777 CACATGACTGGGGAGGCCTCAGG + Intronic
983020311 4:162668992-162669014 CACAGGGCTGGGGAGGCCTCAGG + Intergenic
983305333 4:165977414-165977436 CACACGATTGGAGAGGCCTCAGG - Intronic
984116826 4:175691943-175691965 CAAGGGATGCAGGTGGCCTCTGG + Intronic
985383505 4:189420594-189420616 CACTGTCTTGGGCTGGCCTCGGG - Intergenic
986128923 5:4909437-4909459 CGCAGGACGGGGGTGGCCTCAGG + Intergenic
986183477 5:5415841-5415863 CACAGGGCTGGGGAGGCCTCAGG - Intergenic
987049265 5:14135854-14135876 CACAGGGCTGGGGAGGCCTCAGG - Intergenic
987236695 5:15950055-15950077 CACAGGGCTGGGGAGGCCTCAGG + Intergenic
987542369 5:19271764-19271786 CAAGGAATGGGAGTGGCCTCTGG + Intergenic
987794502 5:22608849-22608871 CACGTGGCTGGGGAGGCCTCAGG - Intronic
988133336 5:27136144-27136166 CACGTGGCTGGGGAGGCCTCAGG + Intergenic
988687363 5:33538167-33538189 CACAGGGCTGGGGAGGCCTCAGG + Intronic
989295464 5:39820168-39820190 CACATGGCTGGGGTGGCCTCAGG + Intergenic
989318001 5:40104416-40104438 CACGGGATTGGCATGTCATCAGG - Intergenic
989373175 5:40731468-40731490 CACAGGGCTGGGGAGGCCTCAGG + Intronic
989603196 5:43219135-43219157 CACAGGGCTGGGGAGGCCTCAGG - Intronic
990947798 5:61267333-61267355 CACGTGGCTGGGGAGGCCTCAGG - Intergenic
991189480 5:63852751-63852773 CACAGGGCTGGGGAGGCCTCAGG - Intergenic
992375828 5:76186730-76186752 CACAGGGATGGGGAGGCCTCAGG + Intronic
993090251 5:83416810-83416832 CACGTGGCTGGGGAGGCCTCAGG - Intergenic
993164264 5:84331582-84331604 CACAGGGCTGGGGAGGCCTCAGG - Intronic
993938699 5:94033127-94033149 CACATGTTTGGGGAGGCCTCAGG - Intronic
994046513 5:95316570-95316592 CACAGGACTGGGGAGGCCTCAGG + Intergenic
995326389 5:110894116-110894138 CACGGGGTTGGGGGAGGCTCAGG + Intergenic
995608006 5:113879205-113879227 CACAGGACTGGGGAAGCCTCAGG - Intergenic
995996261 5:118304238-118304260 CACAGGGCTGGGGAGGCCTCAGG - Intergenic
996623592 5:125541171-125541193 CAAGTGGTTGGGGTGACCTCTGG + Intergenic
996788982 5:127271779-127271801 CACAGGGCTGGGGAGGCCTCAGG - Intergenic
996796587 5:127354552-127354574 CACGGGATTGGAGTGGCAGTGGG + Intronic
997654549 5:135545424-135545446 CTGGGGATGGCGGTGGCCTCCGG + Intergenic
998469905 5:142375575-142375597 GAAGGGAGGGGGGTGGCCTCTGG - Intergenic
998504009 5:142657515-142657537 CACCTGATTGCGGTGGCCTGAGG + Intronic
1000595548 5:163211336-163211358 CAGGGGCGTGAGGTGGCCTCAGG + Intergenic
1000728626 5:164802870-164802892 CACAGGGCTGGGGAGGCCTCAGG + Intergenic
1000788175 5:165571596-165571618 CACAGGCCTGGGGAGGCCTCAGG + Intergenic
1000949851 5:167467335-167467357 CACACGACTGGGGAGGCCTCAGG - Intronic
1001642249 5:173252717-173252739 CACAGGGCTGGGGAGGCCTCAGG + Intergenic
1001724525 5:173885919-173885941 CACGTGACTGGGGAAGCCTCAGG - Intergenic
1002672324 5:180878181-180878203 CACAGGGCTGGGGAGGCCTCAGG + Intergenic
1002717471 5:181236767-181236789 CTCAGGATTGGGGTAGCATCAGG - Intergenic
1003259915 6:4507706-4507728 CACATGGTTGGGGAGGCCTCAGG + Intergenic
1003781192 6:9429080-9429102 CACAGGGCTGGGGAGGCCTCAGG + Intergenic
1006447810 6:34089798-34089820 CATGGGATGGGGGTGGGGTCTGG - Intronic
1006513219 6:34532724-34532746 CTGGGGCTTGGGGTGGCCCCAGG + Exonic
1006696967 6:35939533-35939555 CACATGACTGGGGAGGCCTCAGG - Intergenic
1007865976 6:44971397-44971419 CACAGAACTGGGGAGGCCTCAGG + Intronic
1008125783 6:47666769-47666791 CAGGGGAATAGGGAGGCCTCAGG - Intronic
1008233954 6:49021009-49021031 CACATGGTTGGGGAGGCCTCAGG - Intergenic
1009780851 6:68267473-68267495 CACATGACTGGGGAGGCCTCAGG - Intergenic
1009805063 6:68591673-68591695 CACAGTACTGGGGAGGCCTCAGG + Intergenic
1009929490 6:70160181-70160203 CACGTGGCTGGGGAGGCCTCAGG + Intronic
1010525203 6:76893360-76893382 CACAGGGATGGGGAGGCCTCAGG + Intergenic
1010595201 6:77754716-77754738 CACATGGCTGGGGTGGCCTCAGG + Intronic
1011383922 6:86773169-86773191 CAAGGAATGGGAGTGGCCTCAGG - Intergenic
1012715367 6:102661537-102661559 CACATGACTGGGGAGGCCTCAGG - Intergenic
1012751275 6:103167134-103167156 CACATGGTTGGGGAGGCCTCAGG - Intergenic
1014067516 6:117144787-117144809 CACAGGGCTGGGGAGGCCTCAGG + Intergenic
1014190909 6:118495552-118495574 CGCGTGACTGGGGAGGCCTCAGG - Intronic
1014883804 6:126755768-126755790 CACATGACTGGGGAGGCCTCTGG + Intergenic
1014901367 6:126969816-126969838 CACATGACTGGGGAGGCCTCAGG + Intergenic
1014958216 6:127648558-127648580 CACAGGGCTGGGGAGGCCTCAGG - Intergenic
1014983855 6:127978484-127978506 CACAGGGCTGGGGAGGCCTCAGG - Intronic
1015468566 6:133576258-133576280 CACGTGGCTGGGGAGGCCTCAGG - Intergenic
1015777645 6:136831167-136831189 CACATGACTGGGGAGGCCTCAGG + Intronic
1015896347 6:138020645-138020667 CACGGAATACAGGTGGCCTCTGG - Intergenic
1015954002 6:138581781-138581803 CACTGGGTTGGTGTGGCCTCAGG + Intronic
1016337286 6:143020941-143020963 CACGTGGCTGGGGAGGCCTCAGG + Intergenic
1017199410 6:151736012-151736034 CACATGGCTGGGGTGGCCTCAGG - Intronic
1017326523 6:153146819-153146841 CAAGGAATATGGGTGGCCTCTGG + Intergenic
1017408966 6:154149173-154149195 CACGTGGCTGGGGAGGCCTCAGG + Intronic
1018219681 6:161565641-161565663 CACATGACTGGGGAGGCCTCAGG - Intronic
1018374682 6:163199768-163199790 CACTGAATTGTGGTTGCCTCTGG - Intronic
1018755072 6:166841901-166841923 CAGGAGTTTGTGGTGGCCTCAGG + Intronic
1019127058 6:169847607-169847629 CACATGGTTGGGGAGGCCTCAGG - Intergenic
1019348092 7:540187-540209 GACGGGGTGGGGGTGGCCCCTGG - Intergenic
1019664930 7:2247141-2247163 CACGGGCCTGGGGTTGCCCCAGG - Intronic
1019806546 7:3130561-3130583 CACGTGGCTGGGGAGGCCTCAGG + Intergenic
1019997437 7:4733891-4733913 CATGGGATTGGGGAAGCCACAGG + Intronic
1020720366 7:11737054-11737076 CACATGGTTGGGGAGGCCTCAGG - Intronic
1020906515 7:14070260-14070282 CGCAGGGTTGGGGAGGCCTCAGG - Intergenic
1021482176 7:21130028-21130050 CACAGGGCTGGGGAGGCCTCAGG + Intergenic
1021593444 7:22289955-22289977 CACATGTTTGGGGAGGCCTCAGG - Intronic
1021767863 7:23967545-23967567 CACAGGAAAGGTGTGGCCTCAGG + Intergenic
1022032099 7:26501430-26501452 CGCAGGACTGGGGAGGCCTCAGG - Intergenic
1022218301 7:28287190-28287212 CACATGACTGGGGAGGCCTCAGG + Intergenic
1022580351 7:31547355-31547377 CACAGGGCTGGGGAGGCCTCAGG + Intronic
1022898997 7:34783252-34783274 TACAGGGTTGGGGAGGCCTCAGG + Intronic
1023505554 7:40896668-40896690 CATGGGGCTGGGGAGGCCTCAGG - Intergenic
1023521905 7:41057796-41057818 CACAGGGCTGGGGAGGCCTCAGG - Intergenic
1024449908 7:49527782-49527804 CACAGGGCTGGGGAGGCCTCAGG + Intergenic
1024702231 7:51916662-51916684 CACATGACTGGGGAGGCCTCAGG + Intergenic
1024909007 7:54423028-54423050 CACAGGATTGGAGTTGCCACAGG + Intergenic
1027494752 7:78873682-78873704 CAAGGGAGTGGGGTGGTTTCGGG - Intronic
1028201472 7:87967131-87967153 CACAGGGGTGGGGAGGCCTCAGG - Intronic
1029442052 7:100592327-100592349 CACATGACTGGGGAGGCCTCAGG + Intronic
1029509599 7:100985717-100985739 CTGAGGATTGTGGTGGCCTCTGG + Intronic
1030415635 7:109239240-109239262 CATGGGGCTGGGGAGGCCTCGGG - Intergenic
1030462286 7:109854440-109854462 CACAGGGCTGGGGAGGCCTCAGG - Intergenic
1031645469 7:124220672-124220694 CACATGACTGGGGAGGCCTCAGG - Intergenic
1032311480 7:130791303-130791325 CACATGGTTGGGGAGGCCTCAGG + Intergenic
1033716543 7:144008737-144008759 CACATGGTTGGGGAGGCCTCAGG - Intergenic
1033810339 7:145004302-145004324 CACATGACTGGGGAGGCCTCGGG - Intergenic
1033907146 7:146219012-146219034 CACATGGTTGGGGAGGCCTCAGG + Intronic
1034573266 7:151974049-151974071 CACATGGTTGGGGAGGCCTCAGG - Intronic
1034743068 7:153496183-153496205 CACAGGGCTGGGGTGGCCTCAGG - Intergenic
1034790501 7:153963765-153963787 CACGGGGTGGGGATGGCTTCGGG - Intronic
1036087359 8:5626802-5626824 CACAGGGCTGGGGAGGCCTCAGG - Intergenic
1036412388 8:8514184-8514206 CTCAGGACTGGGGAGGCCTCAGG - Intergenic
1036445810 8:8821044-8821066 CAGGGAAGTGGGGAGGCCTCTGG + Intronic
1036527698 8:9550617-9550639 CACAGGGCTGGGGAGGCCTCAGG + Intergenic
1036752944 8:11454804-11454826 GACAGGACTGGGCTGGCCTCTGG + Intronic
1037405748 8:18540850-18540872 CACGGGAAAGGGGTGGCCCATGG - Intronic
1037595015 8:20347762-20347784 CACGTGGCTGGGGTGGCCTCAGG + Intergenic
1038269870 8:26066416-26066438 CACATGACTGGGGAGGCCTCAGG - Intergenic
1038735051 8:30161245-30161267 CACATGACTGGGGAGGCCTCAGG - Intronic
1038843502 8:31207515-31207537 CACATGGTTGGGGAGGCCTCAGG - Intergenic
1038961609 8:32526300-32526322 CAAGGGATGAGGGTGACCTCTGG - Intronic
1038989139 8:32846931-32846953 CACAGGGCTGGGGAGGCCTCAGG + Intergenic
1039000383 8:32973258-32973280 CACATGACTGGGGAGGCCTCAGG - Intergenic
1039579206 8:38650504-38650526 CTCGGGCTTGCGGTGGCCACGGG + Intergenic
1041775915 8:61522715-61522737 CACATGACTGGGGAGGCCTCAGG - Intronic
1041803456 8:61824421-61824443 CCCAGGACTGGGGAGGCCTCAGG + Intergenic
1042950076 8:74192222-74192244 CACATGAATGGGGAGGCCTCAGG + Intergenic
1043214693 8:77570791-77570813 CACATGGTTGGGGTGGCCTCAGG + Intergenic
1043240562 8:77928840-77928862 CATGTGGTTGGGGAGGCCTCAGG + Intergenic
1043714572 8:83466226-83466248 CACAGGGCTGGGGAGGCCTCAGG - Intergenic
1044514523 8:93122868-93122890 CACAGGGCTGGGGAGGCCTCAGG - Intergenic
1045067100 8:98458837-98458859 CATGTGACTGGGGAGGCCTCAGG - Intronic
1045993557 8:108338282-108338304 CACATGGCTGGGGTGGCCTCAGG + Intronic
1046310306 8:112427515-112427537 CTCAGGACTGGGGAGGCCTCAGG - Intronic
1046438396 8:114226116-114226138 CACAGAACTGGGGAGGCCTCAGG - Intergenic
1046600954 8:116316216-116316238 CACAGGGCTGGGGAGGCCTCAGG + Intergenic
1046607461 8:116387830-116387852 CACAGGGCTAGGGTGGCCTCAGG - Intergenic
1046717887 8:117587044-117587066 CACGTGGCTGGGGAGGCCTCAGG - Intergenic
1047080806 8:121458240-121458262 CACAGGGCTGGGGAGGCCTCAGG - Intergenic
1047714629 8:127584277-127584299 CACAGAACTGGGGAGGCCTCAGG + Intergenic
1047865248 8:129016532-129016554 CACAGGGCTGGGGAGGCCTCAGG - Intergenic
1047889902 8:129296296-129296318 CACAGGGTTGGGGAAGCCTCGGG + Intergenic
1048614404 8:136058444-136058466 CACAGGTCTGGGGAGGCCTCAGG - Intergenic
1048806689 8:138247529-138247551 CACAGGGCTGGGGAGGCCTCAGG - Intronic
1049002168 8:139833046-139833068 CCAGGAATGGGGGTGGCCTCTGG + Intronic
1049665147 8:143839678-143839700 GACGGGGTTGGGGCAGCCTCGGG - Intronic
1050685515 9:8164106-8164128 CTCAGGTTTGGGGAGGCCTCAGG - Intergenic
1050821444 9:9884868-9884890 CATTGGGCTGGGGTGGCCTCAGG - Intronic
1050912299 9:11087056-11087078 CACAGGGCTGGGGAGGCCTCAGG + Intergenic
1053107497 9:35424329-35424351 CACATGACTGGGGAGGCCTCAGG + Intergenic
1054176397 9:61878217-61878239 CTCGGTTTTGTGGTGGCCTCAGG - Intergenic
1054476789 9:65578898-65578920 CTCGGTTTTGTGGTGGCCTCAGG + Intergenic
1054661141 9:67702591-67702613 CTCGGTTTTGTGGTGGCCTCAGG + Intergenic
1054760684 9:69001523-69001545 CACATGACTGGGGAGGCCTCAGG + Intronic
1055850428 9:80621696-80621718 CACGTGGCTGGGGAGGCCTCAGG - Intergenic
1056118403 9:83463369-83463391 CACAGGACTGGGAAGGCCTCAGG + Intronic
1056194322 9:84214739-84214761 CAAGGAATAGAGGTGGCCTCTGG - Intergenic
1056390126 9:86133229-86133251 CACAGGGCTGGGGAGGCCTCAGG - Intergenic
1056880718 9:90390836-90390858 CACATGGCTGGGGTGGCCTCAGG + Intergenic
1057083469 9:92189345-92189367 CCCGGGAGTGGGGTGGGCCCTGG - Intergenic
1057445454 9:95111420-95111442 CATGTGTTTGGGGTGGGCTCTGG - Intronic
1058779536 9:108319080-108319102 CACAGGGCTGGGGAGGCCTCAGG - Intergenic
1058797812 9:108515668-108515690 CACATGGTTGGGGAGGCCTCAGG + Intergenic
1058826258 9:108778365-108778387 CACAGGATTGGGTGGGACTCGGG + Intergenic
1059023159 9:110597941-110597963 CACACGACTGGGGAGGCCTCAGG + Intergenic
1059331484 9:113538378-113538400 CTCTTCATTGGGGTGGCCTCTGG + Intronic
1059605715 9:115832897-115832919 CACATGGTTGGGGAGGCCTCAGG - Intergenic
1059665831 9:116445872-116445894 CTCGGGATGGAGGAGGCCTCAGG + Intronic
1060407346 9:123379434-123379456 CACGGGGTTGGGCTGGCAACAGG - Intronic
1060831808 9:126722314-126722336 GAGGGGCATGGGGTGGCCTCTGG - Intergenic
1061221718 9:129255890-129255912 CACGGGATGGGGGTGGAGACAGG - Intergenic
1061930534 9:133830574-133830596 CACCGGACTGGGGAGGCCCCAGG - Intronic
1062698614 9:137887949-137887971 CACTGGGGTGGGGTGGCCCCTGG + Intronic
1062740243 9:138169153-138169175 CACGTGGCTGGGGAGGCCTCAGG - Intergenic
1203761232 EBV:13651-13673 GACGGGACTGGGGTGGACACAGG - Intergenic
1203762161 EBV:16723-16745 GACGGGACTGGGGTGGACACAGG - Intergenic
1203763090 EBV:19795-19817 GACGGGACTGGGGTGGACACAGG - Intergenic
1203764019 EBV:22867-22889 GACGGGACTGGGGTGGACACAGG - Intergenic
1203764948 EBV:25939-25961 GACGGGACTGGGGTGGACACAGG - Intergenic
1203765877 EBV:29011-29033 GACGGGACTGGGGTGGACACAGG - Intergenic
1203766806 EBV:32083-32105 GACGGGACTGGGGTGGACACAGG - Intergenic
1203767735 EBV:35155-35177 GACGGGACTGGGGTGGACACAGG - Intergenic
1203777047 EBV:79096-79118 CCAGGTATTGGGGTGGCCACGGG + Intergenic
1186589538 X:10915551-10915573 CAGGGGTTGGGGGTGGACTCTGG - Intergenic
1186674030 X:11797147-11797169 CACATGACTGGGGAGGCCTCAGG + Intergenic
1186714129 X:12232300-12232322 CACAGGGCTGGGGAGGCCTCAGG + Intronic
1187328412 X:18313446-18313468 CACATGGTTGGGGAGGCCTCAGG - Intronic
1187448655 X:19378410-19378432 CACGCGGCTGGGGAGGCCTCAGG + Intronic
1187615893 X:20992688-20992710 CACAGGGCTGGGGAGGCCTCAGG + Intergenic
1187663053 X:21572535-21572557 CACAGGACTGGGGAGGCCTCAGG + Intronic
1188041567 X:25375603-25375625 CACAGGGCTGGGGAGGCCTCAGG - Intergenic
1188068900 X:25695390-25695412 CAAGGCATTGGGTTGCCCTCTGG + Intergenic
1188162228 X:26818483-26818505 CACATGACTGGGGAGGCCTCAGG - Intergenic
1188674099 X:32917244-32917266 CACATGACTGGGGAGGCCTCAGG - Intronic
1188736388 X:33721771-33721793 CACATGGTTGGGGAGGCCTCAGG + Intergenic
1188953303 X:36403881-36403903 CATATGATTGGGGAGGCCTCAGG + Intergenic
1188996683 X:36894969-36894991 CACATGGTTTGGGTGGCCTCAGG - Intergenic
1189671931 X:43420325-43420347 CACAGGGCTGGGGAGGCCTCAGG + Intergenic
1190039116 X:47054809-47054831 CAGGGGATTTGGGAGGCCTCGGG + Intronic
1190164515 X:48061818-48061840 CACGGGGGTGGGGAAGCCTCAGG - Intronic
1190333166 X:49248054-49248076 CAGGGGATTAGGGGGTCCTCGGG + Intronic
1190614848 X:52219963-52219985 CACAGGGCTGGGGAGGCCTCAGG + Intergenic
1191095222 X:56666259-56666281 CACAGGGCTGGGGAGGCCTCAGG - Intergenic
1191861051 X:65667176-65667198 CAGGGGATCTGTGTGGCCTCAGG + Intronic
1191985933 X:66981528-66981550 CACATGACTGGGGAGGCCTCAGG + Intergenic
1192113583 X:68389954-68389976 CACAGGGTTGGGAAGGCCTCAGG + Intronic
1192310356 X:70007542-70007564 CACATGGTTGGGGAGGCCTCAGG - Intronic
1192394767 X:70768505-70768527 CACATGACTGGGGAGGCCTCGGG + Intronic
1193814616 X:86090074-86090096 CACATGACTGGGGAGGCCTCAGG + Intergenic
1193845759 X:86467742-86467764 CACAGGGCTGGGGAGGCCTCAGG + Intronic
1193865180 X:86721781-86721803 CACATGACTGGGGAGGCCTCAGG + Intronic
1194253836 X:91612712-91612734 CACAGGACTGGGGAAGCCTCAGG + Intergenic
1194624419 X:96212369-96212391 CACGTGCCTGGGGAGGCCTCAGG + Intergenic
1194952785 X:100146124-100146146 CACAGGGCTGGGGAGGCCTCAGG - Intergenic
1195053971 X:101124813-101124835 CACGTGGCTAGGGTGGCCTCAGG - Intronic
1195428346 X:104761200-104761222 CACAGGGCTGGGGAGGCCTCAGG + Intronic
1195847317 X:109242134-109242156 CACCCTATTGTGGTGGCCTCAGG - Intergenic
1196285405 X:113872944-113872966 CACATGACTGGGGAGGCCTCAGG - Intergenic
1196562271 X:117164154-117164176 CACATGGCTGGGGTGGCCTCAGG - Intergenic
1197392274 X:125882657-125882679 CACATGACTGGGGAGGCCTCAGG - Intergenic
1197410997 X:126116243-126116265 CACATGACTGGGGAGGCCTCAGG - Intergenic
1198035895 X:132800983-132801005 CACAGGGCTGGGGAGGCCTCAGG - Intronic
1198255498 X:134920877-134920899 CCAGAGCTTGGGGTGGCCTCAGG + Intergenic
1198404111 X:136295560-136295582 CCCGGCACTGGGGTGGCCCCCGG + Intergenic
1198836205 X:140807168-140807190 CACAGGGCAGGGGTGGCCTCAGG + Intergenic
1198999008 X:142610422-142610444 CACATGGCTGGGGTGGCCTCAGG + Intergenic
1199060679 X:143351832-143351854 CACAGGGCTGGGGAGGCCTCAGG + Intergenic
1199185332 X:144909665-144909687 CACAGGACTGGGGAGGCCTCAGG + Intergenic
1199207054 X:145160968-145160990 CACAGGGCTGGGGAGGCCTCAGG + Intergenic
1199220168 X:145308574-145308596 CACATGGTTGGGGAGGCCTCAGG + Intergenic
1199337865 X:146641288-146641310 TACATGACTGGGGTGGCCTCAGG - Intergenic
1199619238 X:149684848-149684870 CACAGGGCTGGGGAGGCCTCAGG - Intergenic
1200050172 X:153425063-153425085 CACGGCATCTGAGTGGCCTCGGG - Intergenic
1200345137 X:155440289-155440311 CACAGGCTTGGGGAGGCCTCAGG + Intergenic
1200572621 Y:4852289-4852311 CACAGGACTGGGGAAGCCTCAGG + Intergenic
1200803165 Y:7404947-7404969 CACAGGGTTGGGGAGGCCTCAGG - Intergenic
1201277702 Y:12314129-12314151 CATGGGTTACGGGTGGCCTCTGG - Intergenic
1201357591 Y:13113436-13113458 CATGGGTTACGGGTGGCCTCTGG - Intergenic
1201465373 Y:14274774-14274796 CACAGGGCTGGGGAGGCCTCAGG - Intergenic
1201744438 Y:17355332-17355354 CACATGACTGGGGAGGCCTCAGG - Intergenic