ID: 1130651870

View in Genome Browser
Species Human (GRCh38)
Location 15:85766605-85766627
Sequence CCTTCACTGCAGGGTCTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 240}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130651861_1130651870 -9 Left 1130651861 15:85766591-85766613 CCGCCCGTTCCTTCCCTTCACTG 0: 1
1: 0
2: 4
3: 63
4: 780
Right 1130651870 15:85766605-85766627 CCTTCACTGCAGGGTCTGCAGGG 0: 1
1: 0
2: 0
3: 24
4: 240
1130651857_1130651870 15 Left 1130651857 15:85766567-85766589 CCAGCACCAGATGAGACACTCCT 0: 1
1: 0
2: 2
3: 8
4: 116
Right 1130651870 15:85766605-85766627 CCTTCACTGCAGGGTCTGCAGGG 0: 1
1: 0
2: 0
3: 24
4: 240
1130651859_1130651870 -5 Left 1130651859 15:85766587-85766609 CCTCCCGCCCGTTCCTTCCCTTC 0: 1
1: 1
2: 19
3: 132
4: 1339
Right 1130651870 15:85766605-85766627 CCTTCACTGCAGGGTCTGCAGGG 0: 1
1: 0
2: 0
3: 24
4: 240
1130651860_1130651870 -8 Left 1130651860 15:85766590-85766612 CCCGCCCGTTCCTTCCCTTCACT 0: 1
1: 0
2: 4
3: 134
4: 2887
Right 1130651870 15:85766605-85766627 CCTTCACTGCAGGGTCTGCAGGG 0: 1
1: 0
2: 0
3: 24
4: 240
1130651858_1130651870 9 Left 1130651858 15:85766573-85766595 CCAGATGAGACACTCCTCCCGCC 0: 1
1: 0
2: 0
3: 1
4: 85
Right 1130651870 15:85766605-85766627 CCTTCACTGCAGGGTCTGCAGGG 0: 1
1: 0
2: 0
3: 24
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130651870 Original CRISPR CCTTCACTGCAGGGTCTGCA GGG Intronic
900318867 1:2072729-2072751 CCGTCCCTCCAGGGTCAGCAGGG + Intronic
900464497 1:2818451-2818473 CCTGCCCTGCAGGGGCTGCAGGG + Intergenic
900907787 1:5572915-5572937 CTCTCTCTGCAGTGTCTGCATGG + Intergenic
901011599 1:6205754-6205776 CCTTGGCTGCGGGGTCTTCAAGG - Intronic
903165143 1:21514995-21515017 GCCTCACTACAGGGTCTCCACGG - Intronic
904562271 1:31406816-31406838 CCTCCCCTGCTGGGTCTGCTGGG + Intergenic
906539710 1:46575974-46575996 CCTCCACGGTAGGGTCAGCAGGG - Intronic
910146426 1:84085832-84085854 ACTGCACTGTGGGGTCTGCAGGG - Intronic
910223868 1:84916780-84916802 CCATCTCTGCAGGGTCTGGATGG + Intergenic
912155115 1:106908825-106908847 ACTTCACTGCAGGGTCAGGCTGG - Intergenic
912475386 1:109931373-109931395 CATTCACCTCAGAGTCTGCAAGG - Intergenic
913485545 1:119329738-119329760 CCTTCACTGCAGTGTCAGTTTGG + Intergenic
915035681 1:152922091-152922113 TATTCACTGAAGGATCTGCAGGG - Intergenic
916832893 1:168511185-168511207 TCTTCACTGCATGGCTTGCAGGG + Intergenic
916996759 1:170309663-170309685 CCTTCACTGCAGGCTCATTAAGG - Intergenic
917143650 1:171864180-171864202 CTTTCATTGCAGGGATTGCAAGG + Intronic
917351027 1:174077890-174077912 ACTTCACTCCAGCGTCTGAATGG + Intergenic
917528002 1:175806526-175806548 CCTTAACTGCAGTATCTGTAAGG - Intergenic
918694833 1:187532670-187532692 ACTTCCCTACAGGGTCAGCAAGG - Intergenic
920050559 1:203162286-203162308 CCTAAGCTGCAGGGTCTGCTGGG + Intronic
920387669 1:205580115-205580137 CCCTCACTGCAGGGTGTCCCAGG + Intronic
920960008 1:210655619-210655641 CCCTCAGAGCAGGGTCTGTAAGG + Intronic
922764613 1:228150541-228150563 CCTTGACCACAGGGTCTGCTGGG - Intronic
923601023 1:235403184-235403206 CTTTCACTGGAGGGTTTGTAAGG - Intronic
1062856046 10:779948-779970 TCTACAGTGCAGGGTCTGCGGGG + Intergenic
1062856108 10:780226-780248 TCTTCAGTGCAGGGTCTGTGGGG + Intergenic
1062856123 10:780296-780318 TCTACAGTGCAGGGTCTGTAGGG + Intergenic
1062856192 10:780643-780665 TCTACAGTGCAGGGTCTGCAGGG + Intergenic
1062856248 10:780853-780875 TCTACAGTGCAGGGTCTGTAGGG + Intergenic
1062956645 10:1544514-1544536 TCGTCACGGCAGGGTCTGCAGGG + Intronic
1063040046 10:2328897-2328919 CCTTCACTGCAGGGTTCAGATGG + Intergenic
1067566821 10:47345624-47345646 CCTGCGCTGCAGGTGCTGCAGGG + Intergenic
1070190104 10:74104511-74104533 CAGTCACAGCAGGTTCTGCAGGG - Intronic
1070789908 10:79182779-79182801 CCTTGTCTCCAGGGTCTCCATGG + Intronic
1072802393 10:98401784-98401806 GCCCCACTGCAGGGTCTTCAGGG + Intronic
1076474769 10:130744247-130744269 CCTTGTCTGCAGGGACGGCAGGG - Intergenic
1076482417 10:130793187-130793209 CCTGCACTGCAGACTGTGCAGGG - Intergenic
1076507457 10:130987499-130987521 CCTTTTCTCCAGGGCCTGCAGGG + Intergenic
1078535627 11:12171088-12171110 CCTTCCCTGCAGGGTGGGGATGG + Intronic
1079098150 11:17524302-17524324 CCTTCTCTGCAGGGTGGGTAGGG + Intronic
1081659080 11:44876987-44877009 CGTCCGCTGCAGGCTCTGCAGGG - Intronic
1082784266 11:57308423-57308445 TCTCCATTCCAGGGTCTGCAGGG + Exonic
1082835363 11:57647152-57647174 CCGTCTCTGCGGGGGCTGCACGG - Exonic
1083068378 11:59949433-59949455 CCTTCCCTCCAGGATCTGCGGGG - Intergenic
1083248555 11:61449630-61449652 CCCTCACTGCAAGCTCTGCCTGG + Intronic
1084270079 11:68024288-68024310 CCTTCACTACCGGGTCAGGACGG + Intronic
1084894343 11:72254573-72254595 CATTCACTTTAGGGTGTGCACGG - Intergenic
1085466027 11:76723912-76723934 CCTTGGCTGCAGGGGCTGCAGGG - Intergenic
1086608013 11:88720349-88720371 CCTTCACTTAATTGTCTGCAAGG - Intronic
1087175363 11:95090450-95090472 CCTTCACTTCATGAGCTGCAGGG + Intronic
1088479945 11:110286544-110286566 GCTTCAGTGCAGGCACTGCATGG - Intronic
1088911619 11:114196535-114196557 CCTGCCCTGCAAGGTCTGCCAGG + Intronic
1090359047 11:126160211-126160233 CTTTCTCTGCAGGCCCTGCACGG + Intergenic
1091982439 12:4877305-4877327 CAGTCCCTCCAGGGTCTGCAAGG - Intergenic
1094842568 12:34348238-34348260 CCTCCACTGCTGGGTATGCGCGG - Intergenic
1095393686 12:41739596-41739618 CCTTCATGGCAAGCTCTGCAGGG + Intergenic
1100315714 12:93442393-93442415 CGTTCACTGCAGAGCCAGCAGGG - Intergenic
1101232793 12:102758242-102758264 CCTACTCTGCAGTGTCTTCAAGG + Intergenic
1101803565 12:108043819-108043841 CTTTCACTGCTGAGTTTGCATGG + Intergenic
1101837247 12:108304162-108304184 CCTTCCCTGTAGGGTCTCCATGG + Intronic
1104390807 12:128389334-128389356 CCTCCACTGCACTGTCTTCATGG - Intronic
1104594554 12:130112317-130112339 CCGTCTCTCCAGGGTCAGCAAGG - Intergenic
1104687131 12:130793752-130793774 CCCTCCCTGCAGGGTGTGCCAGG - Intronic
1104997385 12:132666953-132666975 CCTTCACTGTAGACTCAGCACGG - Intronic
1107692235 13:42965466-42965488 CCCTCAAAGCAGGATCTGCAAGG + Intronic
1109130910 13:58584462-58584484 CCTACACTGCAGGTATTGCATGG - Intergenic
1111063240 13:83052175-83052197 CCTTCTTTGCAAGGTCTGAATGG + Intergenic
1111670204 13:91320496-91320518 CCATCATTGGAGGATCTGCAGGG - Intergenic
1113458840 13:110467715-110467737 CCTGCACTCCAGGGTCTCCGTGG + Intronic
1113511142 13:110855620-110855642 CCTTCTCTGCAGAGCCAGCAAGG - Intergenic
1113630230 13:111877411-111877433 ACTTCACACCAGGGTCTCCAGGG + Intergenic
1117297204 14:54391320-54391342 CCCTGACTGCAGCGTCTGCGGGG - Intergenic
1118389166 14:65281841-65281863 CCTTCAGTCCACGTTCTGCAGGG - Intergenic
1119645582 14:76346236-76346258 CCTTAAGGGCAGGATCTGCATGG - Intronic
1121005927 14:90490701-90490723 CCTTCACTGGAGAGGCAGCAAGG + Intergenic
1121307728 14:92917528-92917550 CCTTATCTGCCAGGTCTGCATGG - Intergenic
1121823170 14:96988103-96988125 CATTTATTGCAGGGTCTCCAAGG - Intergenic
1122261747 14:100527555-100527577 CCTCCACTGCAGGGTGTCCCAGG + Intronic
1124041045 15:26103833-26103855 CCTCCACTGCTGGGTCAGAAGGG - Intergenic
1124042574 15:26118708-26118730 CAGTCCCTGCAGGGTCAGCAGGG + Intergenic
1124609838 15:31200937-31200959 CCTTCCCTCCAGGGCCTGCTGGG + Intergenic
1124709290 15:31992224-31992246 CCTTGCCTGCAAGGTGTGCAGGG - Intergenic
1126421036 15:48472306-48472328 CCTTGGCCGCATGGTCTGCAAGG - Intronic
1127211568 15:56779725-56779747 CCCTCACTGCCTGGTCGGCAGGG - Intronic
1128340448 15:66819024-66819046 CCTTCTCTGCAGAGTCTGCGTGG + Intergenic
1129064029 15:72886013-72886035 CCTTCACTGCATATTGTGCAAGG - Intergenic
1130651870 15:85766605-85766627 CCTTCACTGCAGGGTCTGCAGGG + Intronic
1130892019 15:88141440-88141462 CTCACACTGCAGGGGCTGCAAGG + Intronic
1130919193 15:88330005-88330027 CCTTCTCTGCATCATCTGCAGGG - Intergenic
1130932531 15:88439851-88439873 TCTTCTCTACAGGGTCTCCAAGG + Intergenic
1131623411 15:94091661-94091683 CCTCCTATGCAGGGTCTCCATGG - Intergenic
1132573392 16:653764-653786 CCTTCTCTGCGGGGTTGGCAAGG + Exonic
1132802107 16:1759547-1759569 CCCTCACGGCAGGGCCAGCAGGG - Intronic
1133221406 16:4320628-4320650 CCTTCCCTGCATCGTCTGCCTGG + Intronic
1134044604 16:11091980-11092002 CTCTCACTGTAGGGTCTGCTTGG + Intronic
1135244060 16:20839158-20839180 TCTTCACAGCAGTGTCTCCAAGG + Intronic
1136995054 16:35183396-35183418 CTTTCACTGCAGGGACAACATGG - Intergenic
1138961612 16:62035692-62035714 CCTTCACTGCGGGGTCCGTGCGG - Intronic
1139406838 16:66725732-66725754 AGGACACTGCAGGGTCTGCAGGG + Intronic
1139909885 16:70391215-70391237 CCTTCCCTTGAGGGTCTGGAGGG + Intronic
1141841025 16:86574213-86574235 CATTCCCTGCCGGGGCTGCATGG - Intergenic
1143037109 17:4005610-4005632 CCCTCTGTGCAGGGTCTGCAGGG - Exonic
1144328650 17:14205474-14205496 CCTTGACTGAAGGGTCTGCTCGG + Intronic
1144654304 17:17025478-17025500 GCCTCTCTGCAGGGTCTCCAGGG - Intergenic
1147261321 17:39211049-39211071 GCTTCTCTCCAGGCTCTGCAGGG - Exonic
1147670886 17:42176204-42176226 CCTCCACTACAGCGTCTCCAAGG - Exonic
1148852969 17:50563620-50563642 CCTTCACTGAGTGGTCTGGACGG + Intronic
1150659051 17:67059641-67059663 CCTTCAGAGCAGGGCCTGCATGG - Intergenic
1151723676 17:75872842-75872864 CCTTCACTGCCGGGTGAGCTGGG + Intergenic
1151834630 17:76574597-76574619 ACTCCCCTGCAGGGTCTGCAGGG - Intronic
1152288989 17:79428255-79428277 CCCTCACTGCAGGGGCTCCGGGG - Intronic
1152407287 17:80104920-80104942 CCTGCAAAGCAGGGGCTGCAGGG + Intergenic
1153551846 18:6270753-6270775 GCTGCACTGCAGGGGCTGGAGGG + Intronic
1155278031 18:24208658-24208680 CATTCACTGCAGGTTCAACAGGG - Intronic
1157147184 18:45175750-45175772 CCTTTACAGCAGGCTCTTCAAGG - Intergenic
1157399379 18:47374358-47374380 CCTTCTCTGCATGGCCTGCCAGG - Intergenic
1157616579 18:48991042-48991064 CCTTCATAACAGGTTCTGCAGGG - Intergenic
1160445326 18:78922956-78922978 CCTTCAGTGCAAGGGCAGCAGGG + Intergenic
1161244897 19:3245537-3245559 CCTTGTCTGCAGGGTTTGGAGGG - Intronic
1161283843 19:3459001-3459023 CCCTCTCTCCGGGGTCTGCAGGG - Intronic
1161561105 19:4972876-4972898 CCCTCATTGCAGGGCGTGCAGGG - Intronic
1163425149 19:17236739-17236761 CCTGCACTGTAGCCTCTGCAGGG - Intronic
1163680973 19:18682389-18682411 CCTTCACTGCTGAGTCTTGATGG + Intergenic
1163684146 19:18701128-18701150 CCTTCACTGCCGGCTCAGCCGGG + Intronic
1163899773 19:20091095-20091117 CCTTCCCCACAGGGTCTGAAAGG - Intronic
1164976391 19:32575863-32575885 CCATCCCTCCAGGGTCAGCAAGG - Intergenic
1165408649 19:35645075-35645097 CCCGCACTTCAGGGTCTTCAGGG - Intergenic
1166219998 19:41358012-41358034 CTCTCACTGCAGGGGCGGCATGG - Exonic
1166235017 19:41449550-41449572 CCTTGGCTGGAGGGGCTGCAGGG - Intergenic
1166276477 19:41757544-41757566 CCTTCACTTGAGGCTCAGCATGG + Intronic
1166740096 19:45109397-45109419 CCTACACTGCAGGGCCTCCAAGG - Intronic
1166915632 19:46194272-46194294 CGTTGACTCCACGGTCTGCAAGG + Intergenic
1167276547 19:48543560-48543582 CCTTCCCTGCAGTGGCTTCAGGG - Intergenic
1168115196 19:54218399-54218421 CCTTCACAGCAGCATCTGCTGGG + Exonic
1168120901 19:54252092-54252114 CCTTCACGGCAGCATCTGCTGGG + Exonic
1168124476 19:54275989-54276011 CCTTCACGGCAGCATCTGCTGGG + Exonic
925895134 2:8465474-8465496 CTTTCACTGCAGGCTTTCCATGG + Intergenic
926147874 2:10407708-10407730 CCTTCCCCTCAGTGTCTGCAAGG - Intronic
926217366 2:10913782-10913804 CCTTCCCCGCAGGCTCTGGAGGG - Exonic
926545447 2:14234269-14234291 CACTCACTGCAGTGTTTGCAAGG - Intergenic
926728447 2:16016115-16016137 CATTCACTGCAGGTCTTGCATGG + Intergenic
927192007 2:20523470-20523492 CCTCCACAGCAGGGTCATCAGGG + Intergenic
927487705 2:23500126-23500148 CCTTCCCAGCATGGTCTGGAAGG + Intronic
927521830 2:23703632-23703654 CCTTCCCTGGAGGGTCTTCTGGG + Intronic
928144521 2:28760040-28760062 TCTTCACTGGAAGGTCTTCAGGG - Intronic
930619379 2:53627872-53627894 CCCTCACTGCAGTGTCCTCATGG - Intronic
932653716 2:73588264-73588286 CCTGGACTGCAGAGACTGCAGGG - Intronic
932769556 2:74492913-74492935 CCTTCTCAGCAGGGTCAGCGAGG + Exonic
934789859 2:97049945-97049967 CCAACACTGGAGGGTCTGTAGGG - Intergenic
934816610 2:97332594-97332616 CCAACACTGGAGGGTCTGTAGGG + Intergenic
934821086 2:97375890-97375912 CCAACACTGGAGGGTCTGTAGGG - Intergenic
936019039 2:108980889-108980911 CCTTAACTGCAGGGTCCTCATGG + Intronic
936086818 2:109474869-109474891 CCTTCCCTGCTGGCTCTGGAGGG - Intronic
937356345 2:121200329-121200351 CCTGCACAGCAGGGTCCCCACGG - Intergenic
938639801 2:133266590-133266612 CCTTCACTTCGGGGGCAGCAAGG + Intronic
939553483 2:143644334-143644356 CCATCACATCAGGGTCTTCAGGG + Intronic
940361113 2:152797159-152797181 TCTTCTCTGCAGGGGATGCAGGG + Intergenic
945325450 2:208476910-208476932 CTTTCTCTGCAGCGTCTCCAGGG - Intronic
948128350 2:235581839-235581861 CCGTGACTGCAGGATCTCCATGG - Intronic
1172878658 20:38182470-38182492 CCTCAACTGCAGGGGCTGGAAGG + Intergenic
1173194764 20:40905179-40905201 CCTTCTCTACAGCCTCTGCAGGG - Intergenic
1173452694 20:43179138-43179160 CCTTCACTGCAGGATCTCCTGGG + Intronic
1174124083 20:48289853-48289875 CCTCCTCTGCAGAGGCTGCAGGG - Intergenic
1175840798 20:62025905-62025927 CCATCACCCCAGGGTCAGCATGG - Intronic
1175996811 20:62815636-62815658 CCTTCACTGCTGGGTGAGCGCGG - Intergenic
1178638679 21:34328221-34328243 CCTTCACTGCTGTGTCCCCATGG + Intergenic
1179005403 21:37509596-37509618 ACCTCACTGCAGGGTGTGCTGGG - Intronic
1179245980 21:39634636-39634658 GCATCCCTGCAGGGGCTGCAGGG + Intronic
1180061615 21:45388222-45388244 CCTCCACTGGAGGGACTGCTGGG + Intergenic
1180155963 21:45977573-45977595 GCTGCACTGCAGGGTCTGGCTGG - Intergenic
1180320847 22:11320038-11320060 CCTTGGCTGCAGCATCTGCAAGG + Intergenic
1180871081 22:19147836-19147858 CATTCCCTGCAGGGCCTGTAAGG + Intergenic
1181088941 22:20458884-20458906 CCTGGACTGCAGGCTCTGTAAGG + Intronic
1181509260 22:23381753-23381775 CCCCCACGGCAGGGGCTGCAGGG + Intergenic
1182066923 22:27437561-27437583 CATTCACTGCTGTGACTGCAGGG - Intergenic
1182299851 22:29331296-29331318 CCCTCACTCCAGGCCCTGCAGGG + Intronic
1183505121 22:38204437-38204459 GATTCACTTCAGGGTCTCCAGGG + Intronic
1183786516 22:40032068-40032090 CCTGCACAGCAGCTTCTGCAAGG + Exonic
1184198684 22:42949982-42950004 CCTGGACCGCAGGGCCTGCATGG - Intronic
1184275086 22:43405428-43405450 CATTCGCTGCAGGGTCTGCTTGG + Intergenic
1185171578 22:49297581-49297603 CCTTCTCTGCAGGGGGTGCCTGG - Intergenic
953167523 3:40478463-40478485 CCTTAACTGAGTGGTCTGCAGGG - Intronic
953413893 3:42704611-42704633 CACACACAGCAGGGTCTGCAGGG + Intronic
954135952 3:48582322-48582344 CCACCACTGCAGGGTCCCCAGGG + Exonic
954245041 3:49324701-49324723 CTTTGACTGCAAGGTCTGCCTGG + Exonic
954416524 3:50395998-50396020 CCTTAACTGCAAGGCCTGCTTGG + Intronic
956743288 3:72291538-72291560 CCCTCACTGCAGGGACTGACTGG + Intergenic
957577821 3:82032131-82032153 CCCTCACTGCAGTGTCCCCAGGG + Intergenic
959596478 3:108134466-108134488 CCTTCACTGCATGCTCTGAGAGG - Intergenic
963286079 3:143435910-143435932 CCCTCCCTGCAGGGGCTGCCTGG + Intronic
968438720 4:610548-610570 CCTTCAGGGAAGGTTCTGCAAGG - Intergenic
969180149 4:5434167-5434189 CTTTCACTGCATGGGGTGCATGG - Intronic
969348382 4:6583262-6583284 CCTCAACTGCAGGGACTGCTGGG + Intronic
969536213 4:7757425-7757447 CCGTCCCTCCAGGGTCAGCAAGG + Intergenic
977178255 4:93840779-93840801 ACTTCACTGCATGGCCAGCAAGG + Intergenic
977225943 4:94391831-94391853 CCTTCACTGAAGGATCATCAAGG + Intergenic
978857070 4:113405376-113405398 CCTTGAGTTCAGGGTCTGCTTGG - Intergenic
978890842 4:113825425-113825447 CCTCCACTGCAGAGGCTTCAGGG + Intergenic
979107437 4:116705674-116705696 CCTTCCTTGCAGAGGCTGCAGGG - Intergenic
980777603 4:137457091-137457113 CCTTTACAGCTGGGTCAGCATGG + Intergenic
980866835 4:138562080-138562102 CATGCCCTGCCGGGTCTGCACGG + Intergenic
981454069 4:144933533-144933555 CCAACACTGCAGCTTCTGCAGGG - Intergenic
982068037 4:151671899-151671921 CCTGCTCTGCAGCGTCTCCAAGG + Intronic
985002665 4:185501120-185501142 CCTACCTTGCAGGCTCTGCATGG - Intronic
985929645 5:3047085-3047107 TCTCCACTGCAGCATCTGCATGG - Intergenic
988683091 5:33502592-33502614 CTTTGACTGCTGGGTCTGGATGG - Intergenic
992150658 5:73899371-73899393 CCTTCACTGCCTGGCCTGAAGGG - Intronic
995530209 5:113085006-113085028 CCTTCTATGCAGGAGCTGCAAGG - Intronic
997211808 5:132081307-132081329 CCGTCACTGCAGTCTCTTCATGG - Intergenic
997416919 5:133736107-133736129 CCTCCTCGGCATGGTCTGCAAGG - Intergenic
999340379 5:150765005-150765027 CCCTCACCCCAGGGGCTGCAAGG - Intergenic
999389454 5:151179703-151179725 CATTCCCTGCAGTGGCTGCAAGG + Intergenic
1000050233 5:157556617-157556639 CCTTCATTGCAGGGTGTGGAAGG - Intronic
1003395293 6:5747679-5747701 TCCTCACTGCAGGGGCTGCTGGG - Intronic
1004017831 6:11748524-11748546 CATTGACTGTAAGGTCTGCAAGG - Intronic
1005859090 6:29887829-29887851 GCGTGAGTGCAGGGTCTGCAGGG + Intergenic
1005944627 6:30586284-30586306 CCTCCAGTGCTGGGTCTGCATGG + Exonic
1006393662 6:33773313-33773335 CCTTCTCTGCTGGGTCTCTAGGG + Intronic
1010999496 6:82571674-82571696 CCTTCAGTGCAGTGCCTGCCTGG + Intergenic
1012264800 6:97128792-97128814 CCTTCACTGCAGTGCCTGCCAGG - Intronic
1012266327 6:97148450-97148472 ACTTCACTGGAAGGTCTTCAGGG - Intronic
1017219035 6:151944409-151944431 GCTTCACTGAAGGGTCTGGTAGG - Exonic
1017442405 6:154475984-154476006 GCATCACTGCTGGGTTTGCAGGG - Intronic
1019002008 6:168761670-168761692 TGTTCACAGCAGGGCCTGCAGGG + Intergenic
1019070409 6:169340743-169340765 AGCTCACTGCAGGGTCTGCGGGG + Intergenic
1019070421 6:169340795-169340817 TCTCCAATGCAGGGTCTGCGGGG + Intergenic
1019070434 6:169340847-169340869 TCTCCAATGCAGGGTCTGCGGGG + Intergenic
1019070447 6:169340899-169340921 TCTCCAGTGCAGGGTCTGCGGGG + Intergenic
1019180775 6:170186333-170186355 ACCTCACTGCAGGGACTGCAGGG + Intergenic
1019798791 7:3072492-3072514 CTTTCACTGGAGGGGCTGAAAGG + Intergenic
1020736039 7:11950331-11950353 CCTTCACTGCAGCGTCCCCTGGG - Intergenic
1021507866 7:21405206-21405228 CCTTCATCTCAGGGTCTGGAGGG + Intergenic
1022631495 7:32089628-32089650 CATTCATTTGAGGGTCTGCACGG + Intronic
1023166709 7:37350045-37350067 CCTACACTGGAGGGTCTGGATGG + Intronic
1023570380 7:41565606-41565628 CCTCCACTTCAGAGTTTGCAGGG + Intergenic
1024173426 7:46813115-46813137 CTTCCTCTGCATGGTCTGCAAGG - Intergenic
1024476407 7:49816570-49816592 CCTTCTCTCAAGGGTCTTCAAGG + Intronic
1024476578 7:49818506-49818528 CCTTCTCTCAAGGGTCTTCAAGG - Intronic
1024550979 7:50562194-50562216 CCATGAGTGCAGGGGCTGCAGGG + Intronic
1029132152 7:98339778-98339800 CCTTCACTGCAGGCCCAGCATGG + Intronic
1031137702 7:117902914-117902936 ATTTCACTGCAGAGGCTGCAAGG - Intergenic
1032091686 7:128914633-128914655 CCCTCACTCCAGGAGCTGCAAGG + Intergenic
1034117001 7:148592223-148592245 CATGAACTGCAGGGTCAGCAAGG + Intronic
1034499091 7:151438722-151438744 CCTTCACTGGAGAGGCTGAATGG + Intronic
1035093051 7:156330513-156330535 CCTCCAGGGCAGGGTCTGCAGGG + Intergenic
1039122190 8:34159482-34159504 CCATGTCTGCAGGTTCTGCATGG - Intergenic
1041106983 8:54453922-54453944 CCCGCACTGCAGCATCTGCAGGG + Intergenic
1044884423 8:96761436-96761458 CCTCCTCTGTAGGGTCTACAAGG + Intronic
1045523580 8:102924295-102924317 CCAGCACTGCTGGGCCTGCAAGG - Intronic
1046147202 8:110176535-110176557 CCTACATTACAGAGTCTGCATGG + Intergenic
1048383480 8:133889327-133889349 CCTTTACTGTAGAGTTTGCAGGG - Intergenic
1048857609 8:138697741-138697763 CCTGCACTGCAGGGGCTCAAAGG + Intronic
1049228563 8:141470130-141470152 CCTTCAGGGCAGGTTCTGCAGGG + Intergenic
1050780790 9:9332029-9332051 CCCTCTCTGCGGAGTCTGCATGG + Intronic
1053323444 9:37120509-37120531 CCTTCCCTCCCGGGTCTGCGCGG + Intergenic
1054731296 9:68705119-68705141 CCTTCGCTGCAGGGCTTGCGGGG + Intergenic
1056790176 9:89620146-89620168 CCTTGACTTCAGGGTCTCCTTGG + Intergenic
1057311059 9:93943550-93943572 CATTCACTGCAGGGCCTGACGGG + Intergenic
1059153159 9:111967130-111967152 TCTTCTCTGCAGGATCTGCTGGG - Intergenic
1060414161 9:123419019-123419041 ACTTCACTGCTGGGACAGCAGGG + Intronic
1061318924 9:129815571-129815593 CCGTCACTCCTGGGTCTGCGTGG - Intronic
1062168284 9:135119877-135119899 CCAGGTCTGCAGGGTCTGCAGGG - Exonic
1062383742 9:136299988-136300010 CCTGCCCTGCAGGGCCTGCCTGG + Intronic
1189992901 X:46611573-46611595 CCTTCACAGCAGGTTCTGCCTGG - Intronic
1190117060 X:47632579-47632601 TGTTAACTGCTGGGTCTGCAGGG + Intergenic