ID: 1130651916

View in Genome Browser
Species Human (GRCh38)
Location 15:85766896-85766918
Sequence GCTGTCTGTTCCCACCATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 1, 2: 0, 3: 16, 4: 168}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130651913_1130651916 3 Left 1130651913 15:85766870-85766892 CCAGGAGAAACAGGACTCAAACC 0: 1
1: 0
2: 1
3: 26
4: 191
Right 1130651916 15:85766896-85766918 GCTGTCTGTTCCCACCATGCAGG 0: 1
1: 1
2: 0
3: 16
4: 168
1130651910_1130651916 6 Left 1130651910 15:85766867-85766889 CCCCCAGGAGAAACAGGACTCAA 0: 1
1: 0
2: 2
3: 19
4: 210
Right 1130651916 15:85766896-85766918 GCTGTCTGTTCCCACCATGCAGG 0: 1
1: 1
2: 0
3: 16
4: 168
1130651912_1130651916 4 Left 1130651912 15:85766869-85766891 CCCAGGAGAAACAGGACTCAAAC 0: 1
1: 0
2: 1
3: 23
4: 245
Right 1130651916 15:85766896-85766918 GCTGTCTGTTCCCACCATGCAGG 0: 1
1: 1
2: 0
3: 16
4: 168
1130651911_1130651916 5 Left 1130651911 15:85766868-85766890 CCCCAGGAGAAACAGGACTCAAA 0: 1
1: 0
2: 3
3: 34
4: 284
Right 1130651916 15:85766896-85766918 GCTGTCTGTTCCCACCATGCAGG 0: 1
1: 1
2: 0
3: 16
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130651916 Original CRISPR GCTGTCTGTTCCCACCATGC AGG Intronic
900242189 1:1622382-1622404 GCTGCCTCTCTCCACCATGCTGG - Intronic
900646363 1:3710442-3710464 GCTCTGGGGTCCCACCATGCGGG + Intronic
902233456 1:15042994-15043016 GCTGTCTGTTCCTTCCCTGCTGG + Intronic
902536601 1:17122372-17122394 GCTGTCTGTTTCCTCAAAGCAGG - Intergenic
905312135 1:37056624-37056646 GCTGTCTGGGCCCACCCAGCAGG - Intergenic
905543645 1:38780239-38780261 AGTGTCTGCTCCCACCTTGCTGG - Intergenic
907419189 1:54335492-54335514 GCTGTCTCTGCCAGCCATGCAGG - Intronic
907530758 1:55093996-55094018 GCTGTCTATTCTTACCAAGCTGG - Exonic
907887842 1:58610145-58610167 TCTGTATTTTCACACCATGCTGG - Intergenic
909566883 1:77062469-77062491 CCAGTATGTTCCCACCATACTGG - Intronic
911754257 1:101534792-101534814 GCTGTTGGTTCCCATCATTCTGG - Intergenic
912252274 1:108023982-108024004 GCTGTGTATTCCAGCCATGCTGG + Intergenic
912547722 1:110463163-110463185 TCTCTCTGTTCCCACCAGGGTGG - Intergenic
914397529 1:147285176-147285198 GCCTCCAGTTCCCACCATGCAGG + Intronic
914941045 1:152023325-152023347 TCTCTCTGTTCCCACCCTGCTGG + Intergenic
916212017 1:162367171-162367193 GCTGACTTTGCCCACCCTGCGGG + Exonic
917728201 1:177847733-177847755 GCTGTCAGTTACCAACTTGCTGG - Intergenic
919668964 1:200321345-200321367 CCTGTCTCTTCTCACCATGACGG - Intergenic
919934858 1:202244889-202244911 GCCGGCTGTGCCCACCATGGGGG + Intronic
922042817 1:221913789-221913811 GCTGTGTGTTTCCCCCATGATGG + Intergenic
922152961 1:223020907-223020929 AGTTTCTGTTCCCACCAGGCCGG - Intergenic
922722456 1:227905851-227905873 GCAGGCAGTGCCCACCATGCTGG - Intergenic
923546869 1:234929598-234929620 TCATTCTCTTCCCACCATGCAGG + Intergenic
1062799633 10:369518-369540 GCTGTCCGTGCTCACCGTGCAGG - Exonic
1063874733 10:10462287-10462309 GCTGTCAGTTCCAGCCTTGCAGG + Intergenic
1064562040 10:16603136-16603158 GCTTTCTGTTCCCAACATAGTGG + Intronic
1073453896 10:103625160-103625182 GCCTTCTGTTCCAACCAGGCTGG + Intronic
1073508082 10:104020098-104020120 GCTCTCTGTGACCACCATCCTGG - Intronic
1074140351 10:110666988-110667010 CCTTTCTGTTGCCACCATCCTGG + Intronic
1075147495 10:119894664-119894686 GCATTCTGCTCCAACCATGCTGG - Intronic
1075323968 10:121515216-121515238 GATGACTGTTACCACCATACAGG + Exonic
1076922514 10:133461985-133462007 ACTGGCTGTGCCCAACATGCTGG - Intergenic
1077169368 11:1159439-1159461 GGGGTCTGGTCCCCCCATGCTGG + Intronic
1077169388 11:1159508-1159530 GGGGTCTGGTCCCACCATGCTGG + Intronic
1077169420 11:1159615-1159637 GGGGTCTGGTCCCACCATGCTGG + Intronic
1077169431 11:1159662-1159684 GGCGTCTGGCCCCACCATGCTGG + Intronic
1077169452 11:1159729-1159751 GGGGTCTGGTCCCACCATGCTGG + Intronic
1077169465 11:1159776-1159798 GGGGTCTGGTCCCACCATGCTGG + Intronic
1077169475 11:1159823-1159845 GGCGTCTGGCCCCACCATGCTGG + Intronic
1077169525 11:1159992-1160014 GGGGTCTGGTCCCACCATGCTGG + Intronic
1077169534 11:1160039-1160061 GTGGTCTGGTCCCACTATGCTGG + Intronic
1077225007 11:1435822-1435844 GCTGTGTCTTCCCTCCACGCCGG - Intronic
1081677246 11:44977555-44977577 TCTGGCTGCTACCACCATGCTGG - Intergenic
1083923445 11:65792492-65792514 GCTGTCTGTGCCCACAGGGCTGG - Intronic
1087117983 11:94544493-94544515 GCTGCCTGTTCGCGCCATGGGGG + Exonic
1089352667 11:117830271-117830293 GCTTTCTGCTCCAGCCATGCTGG + Intronic
1096554416 12:52394732-52394754 GCCGTCTGTCCCCACCATCTGGG + Exonic
1097038885 12:56142493-56142515 GCCCTCTGTTCCCACCCTCCTGG - Intronic
1099961842 12:89404299-89404321 TCTGTGTGTTTCCACCATCCTGG + Intergenic
1106370665 13:29129735-29129757 ACTGCCTGTGCCCAGCATGCTGG + Intronic
1107130084 13:36885942-36885964 GCTGACTGTTCTCACTATGCGGG + Intronic
1110892105 13:80706356-80706378 GCTCTCAGTCCCCACCTTGCGGG - Intergenic
1112471270 13:99691883-99691905 GCTCTGTGTTCCCACCACCCTGG - Intronic
1114417183 14:22552695-22552717 ACTTTATGTTCCCACCATCCCGG + Intergenic
1114926639 14:27409443-27409465 GCTTTATGTTCCGGCCATGCTGG + Intergenic
1117805240 14:59484172-59484194 GGTGTCTGGGCCCACCCTGCTGG - Exonic
1119928515 14:78520798-78520820 TCTGTCTCTTCCCATCATGAGGG - Intronic
1122783553 14:104153766-104153788 GGTGCCTGTGCCCACCATCCTGG - Intronic
1127388423 15:58486072-58486094 GCTGTGTGTCTCTACCATGCTGG + Intronic
1128065057 15:64759311-64759333 GCTGTCTAATCCCACCACGACGG + Intronic
1129171266 15:73809658-73809680 GCTGTCTGCTTCCCCCAGGCTGG + Intergenic
1129661400 15:77554912-77554934 GCTGAGTGTTCCCAGGATGCTGG + Intergenic
1130651916 15:85766896-85766918 GCTGTCTGTTCCCACCATGCAGG + Intronic
1131909071 15:97176533-97176555 GCTGTGTGTTTCCACTTTGCCGG - Intergenic
1132537686 16:491292-491314 GCTGTCTGTTCCCAGGGTGTGGG + Intronic
1132877119 16:2144857-2144879 GCTGAACTTTCCCACCATGCCGG + Intronic
1134187920 16:12098951-12098973 ACTCTCTGCTCCCACAATGCAGG - Intronic
1134822350 16:17257019-17257041 GCTCTCTGTTGCCTCCTTGCTGG + Intronic
1137486734 16:48897562-48897584 GCTGGCTTCTCCCACCATGCAGG + Intergenic
1138656768 16:58495945-58495967 GCTGTCCCTTCCCACCAGCCTGG - Intronic
1142979724 17:3664582-3664604 GAAGTCTGTTCCTTCCATGCAGG + Intronic
1143554685 17:7652661-7652683 GCCGGCTGTTCCCACCACCCTGG - Intronic
1147847710 17:43416701-43416723 CCTGCCTGTGCCCCCCATGCTGG + Intergenic
1152037435 17:77881811-77881833 TCTGTCTGTCTCCACCGTGCAGG - Intergenic
1152312342 17:79558853-79558875 CCTCTCTGTGCCCTCCATGCTGG - Intergenic
1152774152 17:82189498-82189520 GCTGTCTGCTTCCACCAAGTTGG + Intronic
1154098256 18:11441344-11441366 GCTGTTTTTTCTCACCATGCTGG + Intergenic
1155315440 18:24566559-24566581 GCTGCCTGTTCACATCATGAAGG + Intergenic
1155925028 18:31646789-31646811 GCTGTCTGTAGCCTCCACGCAGG + Intronic
1157011605 18:43655718-43655740 GCTTTATGTTCTGACCATGCTGG + Intergenic
1158041636 18:53101540-53101562 GCTTATTGTTCCCAGCATGCTGG - Intronic
1158547284 18:58406930-58406952 GCTGTCTTTTCCCACTGTGCTGG - Intergenic
1159856647 18:73597466-73597488 GCTTTCTGTCCCAACCATCCTGG - Intergenic
1159922661 18:74239987-74240009 CCTGTCTGTTGCAGCCATGCTGG + Intergenic
1160440323 18:78884516-78884538 GCTGCCTGTGCCCACCATCAGGG + Intergenic
1161932215 19:7348722-7348744 TCTGTGTGTACCCACCATGCTGG + Intergenic
1162725201 19:12686129-12686151 GCTGCCATCTCCCACCATGCTGG + Intergenic
1165162512 19:33826023-33826045 GCTGTCTGTTTTCACCAGGAAGG + Intergenic
1166067951 19:40370990-40371012 GCCCTCTGTTCCCTCCATCCTGG - Intronic
1167143989 19:47671449-47671471 GCTGTAAATTCCCACCATTCAGG + Intronic
925297466 2:2787378-2787400 GCTGTGTACACCCACCATGCAGG - Intergenic
925887138 2:8402581-8402603 GATGTCTGCCCCCACCATTCTGG - Intergenic
926314344 2:11698196-11698218 GCTGTCTGTTCTCCCCTGGCCGG + Intronic
930089950 2:47524859-47524881 GGAGTCTGTCCCCAACATGCAGG - Intronic
931517433 2:63058311-63058333 GTTGTCTGCTGCCAACATGCAGG - Intergenic
932290215 2:70570846-70570868 TTTGTCTGATCCCACAATGCAGG + Intergenic
932631304 2:73345628-73345650 TGTGTCTGTCCCCACCATGCTGG + Intergenic
933549411 2:83756317-83756339 CCTGTCTAATCCCACAATGCAGG + Intergenic
934910675 2:98251604-98251626 GTTGTCATTTGCCACCATGCGGG + Intronic
937979450 2:127606214-127606236 CCTGTCTTTTCCCAACTTGCAGG + Intronic
938102537 2:128506930-128506952 GCGCTCTGTTCCAACCACGCTGG - Intergenic
943429666 2:187783571-187783593 GCCATTTGTTTCCACCATGCTGG + Intergenic
946140647 2:217687895-217687917 CCTGTCTCTTCCCACCAAGAAGG + Intronic
946600769 2:221357505-221357527 GCTGTCTGTTCCTACACTCCAGG + Intergenic
946964785 2:225026317-225026339 GCTGTGTGTTCACAAGATGCAGG + Intronic
947621496 2:231593946-231593968 GCTGACGCTTCCCACCAGGCTGG - Exonic
948166451 2:235866431-235866453 GCTGTCTCTTCCCCACTTGCTGG - Intronic
948816628 2:240513592-240513614 GGTGGCTCTTCCCACCATCCAGG - Intronic
1169021130 20:2331980-2332002 TCTGTCTTTTCCCACCACACAGG + Exonic
1175147964 20:56911008-56911030 CCTCTCTGTTCCCACCATCCTGG + Intergenic
1175267210 20:57710032-57710054 GCTGCCGGTTCCCACCGCGCGGG + Intronic
1175851690 20:62097304-62097326 GCTCTCTGATCCGACCAGGCAGG - Intergenic
1175896259 20:62336765-62336787 GCTGGCTCTTGCCACCCTGCCGG - Exonic
1176932300 21:14828408-14828430 GCAGTATTTTCCCACTATGCTGG + Intergenic
1179395644 21:41038024-41038046 ACTGCCTGTTTCCACCATCCTGG + Intergenic
1180065110 21:45408556-45408578 ACTGTCTGTTCCCAGCAATCAGG - Intronic
1180170892 21:46057614-46057636 GCTGTGAGTCCCCACCACGCAGG + Intergenic
1182079770 22:27520703-27520725 ACAGTCTCGTCCCACCATGCTGG + Intergenic
1183395840 22:37570334-37570356 GCTGACTTTTCCCAACAGGCTGG - Exonic
1183979623 22:41531917-41531939 CCTGTCTGTGCCTCCCATGCAGG - Intronic
1184829652 22:46976398-46976420 GATGTCAGTTCCCACCATCCAGG + Intronic
949624785 3:5853440-5853462 TCTGTCAGTTCCCAACAGGCTGG - Intergenic
951055818 3:18145372-18145394 GCTTACTTCTCCCACCATGCTGG + Intronic
953709305 3:45256726-45256748 GCTGTCTTTCCCCACCATCTTGG - Intergenic
954294134 3:49664846-49664868 GCTGCTTGTACTCACCATGCTGG - Exonic
957202312 3:77152486-77152508 GCTGACTGTGGCCACCATACTGG + Intronic
959401237 3:105904622-105904644 CCTGTCTTTTCCCACTATCCTGG - Intergenic
959694106 3:109231285-109231307 TCAGTCTGTTGCCACCAGGCTGG - Intergenic
961505507 3:127368490-127368512 GCTTTCTCTTCTCACCCTGCAGG - Intergenic
961871834 3:129994000-129994022 GCGGTCTTTTGCAACCATGCTGG + Intergenic
962284333 3:134073974-134073996 TCTGACAGTTGCCACCATGCCGG - Intronic
969499641 4:7544864-7544886 GGCTTCTGTTCCCACCAGGCAGG - Intronic
969626479 4:8308156-8308178 GATGGCTATTCCCACCTTGCGGG + Intergenic
975383939 4:73733227-73733249 GCTGTCTGCTCCAAACTTGCTGG - Intergenic
983433339 4:167679328-167679350 TCTGTCTGTACCCACAAGGCTGG - Intergenic
984101736 4:175495344-175495366 GCCCTCTGTCCCCAGCATGCAGG - Intergenic
986758561 5:10859367-10859389 GCTGTCCGTGCCCACCACCCTGG - Intergenic
987118638 5:14746115-14746137 GCTGTCAGTTCCCCCCGTCCTGG - Intronic
989329942 5:40245413-40245435 ACTGATTGTCCCCACCATGCAGG + Intergenic
989421280 5:41241859-41241881 GCTGTCTTTTCACACTGTGCTGG - Intronic
997205946 5:132050277-132050299 GCTGTGTGGTCCCAGCAGGCTGG - Intergenic
999755028 5:154657956-154657978 GGAGTCTGTCCCCACCTTGCTGG + Intergenic
1000662285 5:163951305-163951327 TGTGTCTGTTCTCACCATGAAGG - Intergenic
1001567051 5:172706618-172706640 GCTGTGTCTTCACACCATGTTGG - Intergenic
1001692997 5:173646717-173646739 GAAGTCTTTACCCACCATGCAGG + Intergenic
1004134119 6:12950203-12950225 ACTCTCTGGTCCCTCCATGCAGG + Intronic
1007334071 6:41138779-41138801 GCTGTCTCTCCCCACCAGACAGG + Intergenic
1008307879 6:49927124-49927146 GCTACCTTTTCCAACCATGCAGG - Intergenic
1017339970 6:153309668-153309690 TCTTTCTGTTCCCCCCGTGCTGG - Intergenic
1020118045 7:5487334-5487356 CCTTTCTCTTCCCACCCTGCTGG - Intronic
1021689113 7:23214984-23215006 GCTGTGTTTTCACACCATGCTGG - Intergenic
1023922255 7:44638912-44638934 GCTGTCTGTCCCCATCCTGGGGG - Intronic
1024046407 7:45588676-45588698 GCTGCCTTTTCCGAGCATGCTGG + Intronic
1024337459 7:48224098-48224120 GCTGTCTGTTCCCACCCTGCTGG + Intronic
1025194754 7:56924082-56924104 CCTGTATGTTCGCACCATGATGG + Intergenic
1025677198 7:63652861-63652883 CCTGTATGTTCGCACCATGATGG - Intergenic
1029490257 7:100866805-100866827 GGTGGCTGTCCCCACCGTGCAGG + Exonic
1035285624 7:157804829-157804851 CCTGCCTCTTCCCACCCTGCAGG + Intronic
1035894798 8:3387444-3387466 GCTGTCTCTGCACACCCTGCTGG + Intronic
1039582156 8:38675562-38675584 GCTATCTCTTCTCACTATGCAGG - Intergenic
1043872205 8:85446176-85446198 CCTGCCTGTTCCCGGCATGCCGG + Exonic
1044247306 8:89963988-89964010 GCTGCCTTTTCCCATCATTCAGG + Intronic
1046663612 8:116975793-116975815 GCTGGCTTTTCCAACCTTGCTGG - Intronic
1049052787 8:140211928-140211950 GCTGTCCGTTCCCACCTGGATGG - Intronic
1049662760 8:143827583-143827605 GTTATCTGTTCCCACCGTCCTGG - Intronic
1050158516 9:2693297-2693319 GTTGTTTGTTCCCACCAAGGAGG - Intergenic
1050739554 9:8804346-8804368 GCTCTCGGTTCCCAAAATGCTGG - Intronic
1053736760 9:41107271-41107293 GCTGTCAGTCCCCGCCACGCGGG - Intergenic
1054691613 9:68324126-68324148 GCTGTCAGTCCCCGCCACGCGGG + Intergenic
1055523443 9:77105882-77105904 TCCCTCTGTTCCCACCATTCTGG - Intergenic
1056111302 9:83397568-83397590 GCAAACTGTTCCCACCATCCTGG - Intronic
1057133202 9:92669201-92669223 GCTGTCTGGTACAACCACGCAGG - Intronic
1057248846 9:93482709-93482731 GCTGTGTGTTCCAACCCTGGAGG - Intronic
1057865175 9:98674698-98674720 GCAGTTTGGCCCCACCATGCTGG - Intronic
1057911641 9:99024177-99024199 GTTGGCTGATCCCACCAGGCTGG - Intronic
1059658591 9:116379025-116379047 GCTTTCTTTTCCCAAAATGCTGG - Intronic
1061033879 9:128102787-128102809 GCTGTCTGTTCTCCCAAAGCTGG + Intronic
1061040626 9:128138996-128139018 GCTCTCAGTCCCCGCCATGCTGG + Intergenic
1061040760 9:128139393-128139415 GCTGTCAGTTCCCGCCTAGCGGG + Intergenic
1061482448 9:130903681-130903703 GCTCTCTGTCCCCATAATGCCGG + Exonic
1062019224 9:134308552-134308574 GGTGTCTGTTCCCATGATGTGGG - Intergenic
1062213267 9:135376005-135376027 GCTGTCTGCTCCGAGCACGCAGG + Intergenic
1194130605 X:90076513-90076535 GCTGTCTTTTCTCACCTTGGTGG - Intergenic
1202063114 Y:20908975-20908997 GTTGTCTTGTCCCACCTTGCTGG - Intergenic
1202328239 Y:23716377-23716399 TCCGTATGTACCCACCATGCTGG + Intergenic
1202542531 Y:25953675-25953697 TCCGTATGTACCCACCATGCTGG - Intergenic