ID: 1130656487

View in Genome Browser
Species Human (GRCh38)
Location 15:85795012-85795034
Sequence CAGTGCAGCCGCAGAAAAGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 210}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130656483_1130656487 7 Left 1130656483 15:85794982-85795004 CCTCTGTGACGGATGGGCAGCCG 0: 1
1: 0
2: 0
3: 1
4: 48
Right 1130656487 15:85795012-85795034 CAGTGCAGCCGCAGAAAAGAAGG 0: 1
1: 0
2: 1
3: 20
4: 210
1130656479_1130656487 23 Left 1130656479 15:85794966-85794988 CCAATCAGAGGCATCGCCTCTGT 0: 1
1: 0
2: 1
3: 5
4: 79
Right 1130656487 15:85795012-85795034 CAGTGCAGCCGCAGAAAAGAAGG 0: 1
1: 0
2: 1
3: 20
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130656487 Original CRISPR CAGTGCAGCCGCAGAAAAGA AGG Exonic
901098726 1:6702704-6702726 CATTTAAGCAGCAGAAAAGATGG - Intergenic
901195681 1:7438618-7438640 CATTGCAGCCACAGGAAGGAGGG - Intronic
901380089 1:8867296-8867318 CAGTACAGCAGGAGAAAAGCTGG - Intronic
903754279 1:25649977-25649999 CAGTACAACCACAGACAAGATGG - Intronic
904235393 1:29113230-29113252 CAGTAAAGCTGCAGAGAAGAGGG + Intronic
906960681 1:50417767-50417789 CAGACCAGCCGCAGGCAAGAGGG + Exonic
908190120 1:61694013-61694035 CACTGCAGCAGGAGAAAATAAGG + Intronic
911572291 1:99532803-99532825 GAGGGCAGCCACAGAAAAGAGGG - Intergenic
915682797 1:157597831-157597853 GATTGCAGCAGCAGAAAAGAGGG + Intronic
916287026 1:163119039-163119061 CTATTCAGCCCCAGAAAAGAAGG + Intronic
917528989 1:175816100-175816122 CTGTGCAGCCGCAGAGGAAATGG + Intergenic
919556815 1:199066304-199066326 TAGTGCAGCCTCAGGGAAGATGG + Intergenic
920188321 1:204176300-204176322 CACTGCAGCAGGAGGAAAGAAGG + Intergenic
921199407 1:212791034-212791056 CAATGCAGCCGCAGACAATGAGG - Intronic
923653807 1:235898262-235898284 CAGTGCAGCCTCAAAAATGTGGG - Intergenic
924525575 1:244844797-244844819 CAGTGCGGCCTCTGAAAACATGG - Exonic
924845650 1:247767323-247767345 CTGTGCAGCCATAGAAAAGAAGG - Intergenic
1063168598 10:3486065-3486087 CAGTGGAGCAGCAGAAATCATGG + Intergenic
1064769527 10:18710228-18710250 CCGCGCAGCCGCAGAGAAGGAGG - Intergenic
1065567346 10:27026761-27026783 CAGTCCAGTCTCAGAAAGGATGG - Intronic
1067469980 10:46528928-46528950 CAGTGCAGTCTCAGACAACAGGG + Intergenic
1069523466 10:69145605-69145627 CAGTGCAGCAGGAGAAAGGATGG - Intronic
1069911151 10:71760725-71760747 ATGTGCAGCAGCAGAAAAGGAGG + Intronic
1070093974 10:73318139-73318161 CAGAGCAGCCCCAGACACGAAGG + Intronic
1070675151 10:78407107-78407129 CAGAGAAGCGGCAGAAAGGAGGG - Intergenic
1071751774 10:88487016-88487038 CAATGCAGCCATAAAAAAGAAGG + Intronic
1074473158 10:113745515-113745537 CAGTGCAGTCGAAGAAAAAGTGG - Intergenic
1074764679 10:116691874-116691896 CATGTCTGCCGCAGAAAAGAAGG - Intronic
1075756594 10:124817216-124817238 AAGTGAAACCGCAGACAAGAGGG + Intronic
1076317409 10:129552145-129552167 CAGTGGGGCCGCAGACAGGAGGG + Intronic
1076862031 10:133142217-133142239 CAGGGCAGCAGCAGAAACCAGGG - Intergenic
1076917981 10:133433992-133434014 GAGTGCAGCTGCTGAGAAGAGGG - Intergenic
1076937979 10:133578069-133578091 GAGTGCAGCTGCTGAGAAGAGGG - Intergenic
1079209429 11:18448115-18448137 TTCTGCAGCCTCAGAAAAGAAGG - Intronic
1079521841 11:21337485-21337507 CACTGCAACAACAGAAAAGAAGG + Intronic
1079990694 11:27243340-27243362 CATTGCAGCAGCAGAGAAAAGGG - Intergenic
1083446698 11:62712607-62712629 CAGTGCAGCCACAGGAGATAGGG + Intronic
1084248508 11:67877555-67877577 CAGATCAGCCGCTCAAAAGAAGG - Intergenic
1087785297 11:102347352-102347374 CAGTGCGGGCGCAGCAAACACGG - Exonic
1089214719 11:116828886-116828908 CAGTGAAGCCGCAGCAGGGATGG - Intergenic
1089292348 11:117444970-117444992 GAGAGCAGCCCCAGAACAGATGG + Intronic
1090556211 11:127879150-127879172 GAGTGCAGGCACAGAAAAGATGG - Intergenic
1090839355 11:130475103-130475125 CTGTCCAGCCACAGAAATGAGGG + Exonic
1093056801 12:14564128-14564150 CATTGCAGCCTCAGAGTAGATGG - Intronic
1094173711 12:27521218-27521240 CACTCCAGCTGCAGAAAGGATGG + Intergenic
1094582890 12:31750661-31750683 CAGTGCTGCAGCAGAGGAGATGG + Intergenic
1095799800 12:46259972-46259994 CTGTGTAGCCCCAGGAAAGAAGG + Intronic
1095843995 12:46726258-46726280 CTGTTCAGCCTTAGAAAAGAAGG - Intergenic
1097192439 12:57225981-57226003 GAGTGCAGCCCCAGAATAGGCGG + Exonic
1098908862 12:76188950-76188972 CAGTGTAGCTGGAGAAAAGTAGG - Intergenic
1101575441 12:105992982-105993004 CAGTGCAGCCACTGAACAAATGG + Intergenic
1102216783 12:111167228-111167250 CAGTGCAGGTGAAGGAAAGAAGG - Intronic
1102306515 12:111808835-111808857 CAGTGCAGGTGGAGAAAAGAGGG + Intronic
1102632616 12:114294827-114294849 CTGTCCAGCAGCAGGAAAGATGG + Intergenic
1102717026 12:114982848-114982870 CATTCCAGCTGGAGAAAAGAGGG + Intergenic
1104151059 12:126083709-126083731 CAGGGCAGCTGCAGGAAAGTTGG + Intergenic
1104401519 12:128480544-128480566 GACTGCAGCCTCAGAAAAGGGGG - Intronic
1105802072 13:23914853-23914875 CAGTCCAATCGCAGAAAAGATGG + Intergenic
1108584994 13:51863379-51863401 CAGTGCAGGGGCAGATGAGAGGG + Intronic
1109826569 13:67729063-67729085 CAGTGCAGATTCAGAGAAGAAGG - Intergenic
1111637065 13:90919410-90919432 CATTGCAGCAGCAGAAGAGAGGG + Intergenic
1113852145 13:113423901-113423923 CAGTGCAGCCTTAGAATAGGTGG - Intronic
1114679512 14:24473060-24473082 CAGTGCAGCGGCAGAATAAAGGG - Intergenic
1114683151 14:24504416-24504438 CAGTACACCCTCAGAAATGATGG + Intronic
1115518192 14:34206213-34206235 CAGTGAAGCAGCAGAAAAGAAGG - Intronic
1116390420 14:44384384-44384406 CAGTGCAGCCCGAAAAAGGAAGG + Intergenic
1116424922 14:44779230-44779252 CAGTGCAGCTGCTGAGCAGAGGG - Intergenic
1117951717 14:61089586-61089608 CAGTGCAGGCCCAGGAAAGAGGG - Intergenic
1118458772 14:65969018-65969040 CAGTCCAGCTGCAGACCAGAGGG - Intronic
1118745585 14:68770719-68770741 CAGTCCAGCGGCAGCAAGGATGG + Intergenic
1119799094 14:77426730-77426752 CAGTTCAGTCACAGAAAAGGAGG + Exonic
1122505935 14:102231780-102231802 CTGGGCAGCCACAGAAAAGCTGG - Exonic
1125213647 15:37244116-37244138 AAGTGAAACCGCAGATAAGAGGG - Intergenic
1126753077 15:51897189-51897211 CAGTGTAGACTGAGAAAAGAAGG - Intronic
1128509928 15:68307185-68307207 TAGGGCAGCCGCTGAAAAGAGGG - Intronic
1128829385 15:70753158-70753180 CAGGGCATCAGCAGAAAAAATGG + Intronic
1129265956 15:74393180-74393202 CAGTGCAGCCAGAGAGAGGAGGG - Intergenic
1129442492 15:75591880-75591902 CTGTGCAGCAGCAGAGAGGAGGG + Intergenic
1129973702 15:79803403-79803425 CTGTGCAGCTGCTGAGAAGATGG + Intergenic
1130013172 15:80168038-80168060 AAGTGCAGCCTGAGAAAGGAAGG - Exonic
1130656487 15:85795012-85795034 CAGTGCAGCCGCAGAAAAGAAGG + Exonic
1131392530 15:92061145-92061167 CAGTGCAAAGGTAGAAAAGAGGG - Intronic
1131873715 15:96783716-96783738 CAAGGCAGCCTCTGAAAAGAGGG - Exonic
1132125524 15:99220809-99220831 CTGTGCAGCCTAAGACAAGATGG - Intronic
1133186895 16:4106394-4106416 CGGTGCTGCCGCGGAACAGAAGG - Intronic
1133734657 16:8605714-8605736 GATTGCAGCCTCATAAAAGATGG + Intergenic
1135050714 16:19190735-19190757 CAGTTCAGCCTTAGAAAGGAAGG - Intronic
1135170873 16:20182240-20182262 CAGAGGAGCCAAAGAAAAGAAGG + Intergenic
1135905129 16:26505021-26505043 TAGGGCAGCAGCACAAAAGATGG + Intergenic
1137847720 16:51708470-51708492 TAGTGGAGCTGGAGAAAAGATGG + Intergenic
1138081394 16:54094305-54094327 CACTGGAGCCTCGGAAAAGAAGG - Intronic
1138163503 16:54778032-54778054 CAGTTCAGCTTCAGAAAAGCTGG - Intergenic
1140020810 16:71237050-71237072 CAGTGCAGCCACAGAAGCCAAGG + Intergenic
1143249625 17:5513557-5513579 CTGTGCCACTGCAGAAAAGATGG + Intronic
1144008038 17:11118975-11118997 AAGTGAAGCAGCAGAAAAGTAGG + Intergenic
1145838088 17:27969993-27970015 CAGTGAAGCTGGAGAAAAGAGGG - Intergenic
1146140808 17:30366438-30366460 CAATGAAGCCACACAAAAGAGGG - Intergenic
1147787689 17:42991470-42991492 CAGTGCAGACTCAGAATTGAAGG + Exonic
1149233401 17:54563025-54563047 CTGTGCAGGGGCAGAATAGATGG + Intergenic
1151998183 17:77625358-77625380 CAGTGCAACGACAGAAGAGAAGG - Intergenic
1152867612 17:82733830-82733852 CAGGGCTGCCGCAGAACAGCAGG - Intergenic
1159862949 18:73670977-73670999 CTGTGCAGCCATAAAAAAGAAGG + Intergenic
1160854825 19:1212045-1212067 CTGGGCAGCCGCAGAACAGCGGG + Intronic
1163325918 19:16603189-16603211 CAGGGCAGCCAAAGAAGAGAGGG + Intronic
1164451651 19:28371244-28371266 CATTGGAGACTCAGAAAAGAGGG - Intergenic
1165166212 19:33859012-33859034 CACTGCAGCCCCATAAAAGGGGG + Intergenic
1168484751 19:56751451-56751473 AAATGCAGCTGCAGAGAAGAAGG + Intergenic
926231352 2:11006428-11006450 CACAGCAGCCACAGAAAAGAGGG + Intergenic
926308346 2:11656782-11656804 CAGTCCAAACGCAGATAAGACGG - Intergenic
927074148 2:19560115-19560137 GAGGGCAGCTGCAGAACAGATGG - Intergenic
928608733 2:32969905-32969927 CAGTGAAGCTGCAGAAAAAAAGG - Intronic
931352236 2:61501779-61501801 CACTGCAGCCACATAAATGATGG + Intronic
932066058 2:68562049-68562071 CAATTCAGCCTTAGAAAAGATGG + Intronic
937009122 2:118545853-118545875 CAGGGCAGAAGAAGAAAAGATGG + Intergenic
939215139 2:139227571-139227593 CAGTGTTACCACAGAAAAGAGGG - Intergenic
939673567 2:145043630-145043652 CTGTGCAGCTGCAGAATAAAAGG + Intergenic
943343295 2:186707373-186707395 CAGAGCAGAGGCAGTAAAGATGG - Intronic
945002752 2:205369091-205369113 TCTTGCAGCCACAGAAAAGAGGG - Intronic
945505523 2:210635411-210635433 CAGTGCTGCCCCAGAAGATAAGG - Intronic
946020559 2:216637028-216637050 CAGTGCAGCTTCAAAAAAAAAGG + Intronic
947043209 2:225948418-225948440 GAGAGCAGTCCCAGAAAAGATGG + Intergenic
947102296 2:226634104-226634126 AAGTGCAGCAGGAGGAAAGATGG - Intergenic
947162906 2:227232141-227232163 CTATGCAGCCACAAAAAAGAAGG - Intronic
948348528 2:237319519-237319541 CAGTGCAGCCAGAAAAAAGCAGG + Intergenic
1169784878 20:9348888-9348910 CAGTGCAGCTGCAGAGAACCTGG - Intronic
1171055050 20:21898507-21898529 CAGTGAAGAAGCAGAAAAAATGG - Intergenic
1172286179 20:33742072-33742094 CAGTAGAGCCACAGGAAAGAAGG - Intronic
1172971374 20:38875385-38875407 CCGTGCAGCAGCAGAAACCAGGG - Intronic
1173423757 20:42925810-42925832 CAGAGCAGCTGAAGAAAAGAGGG + Intronic
1174543054 20:51304757-51304779 TGGTGCAGCAGCAGAAGAGAAGG + Intergenic
1178468602 21:32871516-32871538 CTGTGCAGCAGCAGAGAAAATGG - Intergenic
1178702010 21:34841611-34841633 CACTGCTGCCGGAGCAAAGAGGG - Intronic
949606257 3:5657552-5657574 CATTGCAGCTGGAGAATAGAGGG + Intergenic
950316806 3:12008869-12008891 AAGTACAACTGCAGAAAAGAGGG + Intronic
950335959 3:12193299-12193321 CAGTGCAGCAGCAGAACTCATGG + Intergenic
950758374 3:15197332-15197354 CAGTGCAGGGGCAGAAGAAATGG - Intergenic
951641714 3:24844088-24844110 CCGTGCATCTGCAGAACAGATGG - Intergenic
952254652 3:31684741-31684763 CAGAGCTGCCGCAGACAAGAGGG + Intronic
953415381 3:42712679-42712701 CAGTGGAGCCACAAAACAGAGGG + Intronic
953783891 3:45896295-45896317 CAAAGCAGCCCCAGATAAGAAGG + Intronic
954154881 3:48679932-48679954 CTGTGCAGCCGCACAAGAGAGGG + Intronic
957940003 3:86991580-86991602 CAGAGCAGGCGCAGAATACACGG + Intergenic
958669302 3:97181853-97181875 CAGTGGAGCCATCGAAAAGAAGG - Intronic
959424819 3:106174143-106174165 CAGTGCAGACTCTGAAATGAAGG + Intergenic
959494013 3:107027808-107027830 CATTGGAGCCTCAGAAAAGGGGG + Intergenic
960400182 3:117187810-117187832 TTGTGCAGCCACACAAAAGAAGG + Intergenic
963044859 3:141094938-141094960 CAGTGCAGCCACTGAGAAAATGG - Intronic
963618931 3:147579866-147579888 CAGTGTAGCCACAGAAGAGAAGG + Intergenic
969107993 4:4822483-4822505 CAGTGCAGCGGGAGAAATGCAGG + Intergenic
970309086 4:14762759-14762781 CAGAGAAGCCGCAGGACAGAAGG + Intergenic
971003306 4:22346696-22346718 CAGAGCAGGCGCAAAAAAGGGGG - Intronic
971777517 4:30985799-30985821 CACTGCAGCCCCAGAAACAATGG - Intronic
973928102 4:55760490-55760512 CAGTGCAGCCACAGTGAACACGG - Intergenic
977200403 4:94108148-94108170 CCGTGAAGCCTCAGAAGAGATGG + Intergenic
977662233 4:99603231-99603253 CAGTGGAGACACAGGAAAGATGG + Intronic
979108828 4:116724036-116724058 CTATGCAGGCCCAGAAAAGATGG + Intergenic
982156381 4:152525633-152525655 CTGTGCAGCCATAAAAAAGAAGG - Intronic
982448378 4:155521992-155522014 GTGTTCAGCAGCAGAAAAGAAGG - Intergenic
982613385 4:157607124-157607146 CGGTTCAGCCACAAAAAAGAGGG + Intergenic
983826231 4:172264910-172264932 CAGTGCAACCACAAAAGAGATGG + Intronic
984581663 4:181516998-181517020 CAGTGCATCAGTACAAAAGAGGG - Intergenic
984608768 4:181814810-181814832 CAGAGCAGAAGCAGAAGAGAGGG + Intergenic
990804896 5:59649107-59649129 CAGGGCAGCCGCCTAAGAGAAGG + Intronic
992744186 5:79803269-79803291 CAGTACAGCCACACAGAAGAAGG + Intergenic
992845904 5:80747087-80747109 TAGAGCAGACGCAGACAAGATGG + Intronic
993746129 5:91599218-91599240 CAGTTCACCAGCAGAGAAGATGG - Intergenic
998049466 5:139020010-139020032 CTGTGCAGCCACTGGAAAGATGG - Intronic
998336322 5:141375492-141375514 CAGTGCATTCACAGAGAAGATGG - Exonic
999138203 5:149337966-149337988 CAGAGCAGCTGGAGCAAAGAGGG + Intronic
999320389 5:150611420-150611442 CAGTTCAGCCTCAGAATAGTGGG - Intronic
1002086079 5:176776479-176776501 CAGGGCAGCCACAGAAGAGGGGG - Intergenic
1003722078 6:8715032-8715054 CAGTGCAGATGGAGAACAGAAGG - Intergenic
1007731713 6:43951491-43951513 CAGTGCAGCCAGAGACAGGAGGG + Intergenic
1008265151 6:49415930-49415952 TATTGCAGCCTCAGAAAATATGG - Intergenic
1010055591 6:71560357-71560379 CAGTGCAGCCTCAGAAATGGAGG + Intergenic
1011629749 6:89312002-89312024 CAGTGCAGACCCAGGAAGGATGG + Intronic
1011787107 6:90859318-90859340 CAGTGCAGCCGCAGCCATGTGGG + Intergenic
1014055692 6:117013001-117013023 AATTGGAGCCCCAGAAAAGAAGG + Intergenic
1014142915 6:117964839-117964861 CAGTGCTGCAGCAGAGGAGACGG + Intronic
1015284245 6:131466792-131466814 CACTTCTGCCACAGAAAAGAGGG - Intergenic
1016430736 6:143982632-143982654 CAGTGCAGTAGCAGAAGAGCTGG + Intronic
1017958882 6:159204601-159204623 CAGTGAGGCCGCTGAAATGACGG - Intronic
1018142307 6:160850908-160850930 CACTGAACCCACAGAAAAGACGG + Intergenic
1018142576 6:160853931-160853953 CAGTGAACCCAGAGAAAAGATGG - Intergenic
1018723147 6:166589003-166589025 GAGTGCCCCCGCAGAAAAGGAGG + Intronic
1024396229 7:48870717-48870739 CAGTTCATCTGCATAAAAGATGG + Intergenic
1025021712 7:55485633-55485655 CAGTGCAGCCACAGGACAGCCGG - Intronic
1025911519 7:65832506-65832528 CAGTGGAGCAGAAGGAAAGAGGG + Intergenic
1025919970 7:65902539-65902561 AATTGGAGCCCCAGAAAAGAGGG + Intronic
1026845109 7:73694320-73694342 GAGGGCAGCATCAGAAAAGAAGG - Intronic
1026920838 7:74154110-74154132 CAGGGCAGCCGTAGAAAGGAAGG - Intergenic
1027034692 7:74916559-74916581 CAGTGAATCCTCAGGAAAGAAGG + Intergenic
1027505827 7:79016372-79016394 CAGTGCAGCCTCAGAAATCTAGG + Intronic
1030568496 7:111191027-111191049 CACTGCAGTGGCAGATAAGAAGG + Intronic
1030640544 7:112001201-112001223 AAGTGAAACCGCAGATAAGAAGG - Intronic
1032311167 7:130788647-130788669 CAGTCCAGCCACACAAAAGCTGG - Intergenic
1035025278 7:155820871-155820893 CACTGCAGCTTCAGAAAGGATGG + Intergenic
1036545766 8:9768215-9768237 CAGTGCAGCCCCAGGGAAGCAGG + Intronic
1038303983 8:26383027-26383049 CGGCGCAGGCGCAGAAAAGGGGG + Exonic
1040960529 8:53027367-53027389 CAGTGCAGCAGGGGCAAAGAAGG + Intergenic
1041519167 8:58736218-58736240 CCTTTCAGCCGTAGAAAAGAAGG + Intergenic
1041740324 8:61150731-61150753 AAGTGAAACCACAGAAAAGAGGG - Intronic
1042155398 8:65840828-65840850 CAGCCCAGCCACAGAAACGAAGG + Intronic
1042939536 8:74093246-74093268 CAGTGCAACAGTAGAAAGGAAGG - Intergenic
1043267768 8:78287815-78287837 CTATGCAGCCATAGAAAAGAAGG - Intergenic
1046354040 8:113055461-113055483 AAGTGCACACTCAGAAAAGAAGG - Intronic
1048166825 8:132069125-132069147 CAATGTAGCTGCAGCAAAGATGG - Intronic
1049593977 8:143475107-143475129 CAGGGCAGCCGGAGAATGGAGGG - Intronic
1051884458 9:21875724-21875746 CTATGCAGCCACTGAAAAGAAGG - Intronic
1052199849 9:25764457-25764479 CACAGCAGCCCCAGAGAAGAGGG + Intergenic
1052778155 9:32753988-32754010 GAGTGCAGTGGCAGAGAAGAGGG + Intergenic
1055637659 9:78294811-78294833 CAGTGGAGACACAGCAAAGAGGG - Intergenic
1055981569 9:82008013-82008035 CATTGAAACAGCAGAAAAGAAGG + Intergenic
1056076273 9:83044195-83044217 CAGAGCATCTGCAGAAAGGAGGG + Intronic
1058567137 9:106298054-106298076 CAGTGTAGTCAGAGAAAAGAGGG + Intergenic
1059736326 9:117103556-117103578 CAGGGCAGCCCAAGAATAGAAGG - Intronic
1060720000 9:125970362-125970384 CAGCACAGCCGGAGAAAAGGGGG - Intergenic
1061005191 9:127924998-127925020 CAGTGCAGCCAAAGACATGAAGG - Intronic
1062703542 9:137921123-137921145 AAGTGCAGATGGAGAAAAGAAGG + Intronic
1185632320 X:1524265-1524287 GAGTGGATCCGCAGAAGAGAGGG - Intronic
1186077781 X:5899045-5899067 CATGGCAGCCCCATAAAAGAAGG - Intronic
1189545648 X:42040013-42040035 CAATGCAGCCATAAAAAAGAAGG - Intergenic
1191259060 X:58292721-58292743 CAGTGCAGGGGCTGCAAAGAAGG - Intergenic
1192265408 X:69534069-69534091 CAGTGCAGCCGCCCAAACCATGG - Intergenic
1195010299 X:100727045-100727067 CAGTGCAGCAGGAGGAGAGAAGG - Intronic
1195872317 X:109499291-109499313 CAGTGGAGTGGCAGAAGAGAGGG + Intergenic
1196058940 X:111386698-111386720 CAGTTCATCCAGAGAAAAGAGGG - Intronic
1196866995 X:120078953-120078975 CTATGCAGCAGCAGGAAAGAAGG - Intergenic
1196876104 X:120157329-120157351 CTATGCAGCAGCAGGAAAGAAGG + Intergenic
1199575873 X:149313038-149313060 CAGTGCAGCCACAGAAATCTGGG + Intergenic
1199814579 X:151386482-151386504 CAGTGCATCCCCAGGAGAGATGG + Intergenic
1199932154 X:152534178-152534200 CTATGCAGCCAAAGAAAAGAAGG - Intergenic