ID: 1130656639

View in Genome Browser
Species Human (GRCh38)
Location 15:85795869-85795891
Sequence TCCCACCTCCACCTCCGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130656639_1130656649 28 Left 1130656639 15:85795869-85795891 CCCTGACGGAGGTGGAGGTGGGA No data
Right 1130656649 15:85795920-85795942 AAAGATTTGGGAGAGGGGATAGG No data
1130656639_1130656645 16 Left 1130656639 15:85795869-85795891 CCCTGACGGAGGTGGAGGTGGGA No data
Right 1130656645 15:85795908-85795930 AAGAAAGTGTACAAAGATTTGGG No data
1130656639_1130656648 23 Left 1130656639 15:85795869-85795891 CCCTGACGGAGGTGGAGGTGGGA No data
Right 1130656648 15:85795915-85795937 TGTACAAAGATTTGGGAGAGGGG No data
1130656639_1130656643 -10 Left 1130656639 15:85795869-85795891 CCCTGACGGAGGTGGAGGTGGGA No data
Right 1130656643 15:85795882-85795904 GGAGGTGGGAGGTGCAAGGAAGG No data
1130656639_1130656644 15 Left 1130656639 15:85795869-85795891 CCCTGACGGAGGTGGAGGTGGGA No data
Right 1130656644 15:85795907-85795929 TAAGAAAGTGTACAAAGATTTGG No data
1130656639_1130656646 21 Left 1130656639 15:85795869-85795891 CCCTGACGGAGGTGGAGGTGGGA No data
Right 1130656646 15:85795913-85795935 AGTGTACAAAGATTTGGGAGAGG No data
1130656639_1130656647 22 Left 1130656639 15:85795869-85795891 CCCTGACGGAGGTGGAGGTGGGA No data
Right 1130656647 15:85795914-85795936 GTGTACAAAGATTTGGGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130656639 Original CRISPR TCCCACCTCCACCTCCGTCA GGG (reversed) Intergenic
No off target data available for this crispr