ID: 1130656643

View in Genome Browser
Species Human (GRCh38)
Location 15:85795882-85795904
Sequence GGAGGTGGGAGGTGCAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130656628_1130656643 25 Left 1130656628 15:85795834-85795856 CCTGGGGCGGGGAAATTCCCAGG No data
Right 1130656643 15:85795882-85795904 GGAGGTGGGAGGTGCAAGGAAGG No data
1130656639_1130656643 -10 Left 1130656639 15:85795869-85795891 CCCTGACGGAGGTGGAGGTGGGA No data
Right 1130656643 15:85795882-85795904 GGAGGTGGGAGGTGCAAGGAAGG No data
1130656627_1130656643 30 Left 1130656627 15:85795829-85795851 CCAAGCCTGGGGCGGGGAAATTC No data
Right 1130656643 15:85795882-85795904 GGAGGTGGGAGGTGCAAGGAAGG No data
1130656632_1130656643 7 Left 1130656632 15:85795852-85795874 CCAGGAAGCAGAGGTCACCCTGA No data
Right 1130656643 15:85795882-85795904 GGAGGTGGGAGGTGCAAGGAAGG No data
1130656631_1130656643 8 Left 1130656631 15:85795851-85795873 CCCAGGAAGCAGAGGTCACCCTG No data
Right 1130656643 15:85795882-85795904 GGAGGTGGGAGGTGCAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130656643 Original CRISPR GGAGGTGGGAGGTGCAAGGA AGG Intergenic
No off target data available for this crispr