ID: 1130656649

View in Genome Browser
Species Human (GRCh38)
Location 15:85795920-85795942
Sequence AAAGATTTGGGAGAGGGGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130656639_1130656649 28 Left 1130656639 15:85795869-85795891 CCCTGACGGAGGTGGAGGTGGGA No data
Right 1130656649 15:85795920-85795942 AAAGATTTGGGAGAGGGGATAGG No data
1130656640_1130656649 27 Left 1130656640 15:85795870-85795892 CCTGACGGAGGTGGAGGTGGGAG No data
Right 1130656649 15:85795920-85795942 AAAGATTTGGGAGAGGGGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130656649 Original CRISPR AAAGATTTGGGAGAGGGGAT AGG Intergenic
No off target data available for this crispr