ID: 1130660027

View in Genome Browser
Species Human (GRCh38)
Location 15:85824059-85824081
Sequence ATGAAGAAACAGGCTGATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130660023_1130660027 11 Left 1130660023 15:85824025-85824047 CCGTGTGGAATAAAGCTATTTTA No data
Right 1130660027 15:85824059-85824081 ATGAAGAAACAGGCTGATGGAGG No data
1130660022_1130660027 22 Left 1130660022 15:85824014-85824036 CCTTAAAACAACCGTGTGGAATA No data
Right 1130660027 15:85824059-85824081 ATGAAGAAACAGGCTGATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130660027 Original CRISPR ATGAAGAAACAGGCTGATGG AGG Intergenic
No off target data available for this crispr