ID: 1130674084

View in Genome Browser
Species Human (GRCh38)
Location 15:85937113-85937135
Sequence TGGGTTCACCCCCTGCATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130674084_1130674091 19 Left 1130674084 15:85937113-85937135 CCCACATGCAGGGGGTGAACCCA No data
Right 1130674091 15:85937155-85937177 TTTTGTCTTGGCTGCCTACCTGG No data
1130674084_1130674088 7 Left 1130674084 15:85937113-85937135 CCCACATGCAGGGGGTGAACCCA No data
Right 1130674088 15:85937143-85937165 GCCCTTCAGCTGTTTTGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130674084 Original CRISPR TGGGTTCACCCCCTGCATGT GGG (reversed) Intergenic
No off target data available for this crispr