ID: 1130674091

View in Genome Browser
Species Human (GRCh38)
Location 15:85937155-85937177
Sequence TTTTGTCTTGGCTGCCTACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130674081_1130674091 27 Left 1130674081 15:85937105-85937127 CCTGTGACCCCACATGCAGGGGG No data
Right 1130674091 15:85937155-85937177 TTTTGTCTTGGCTGCCTACCTGG No data
1130674083_1130674091 20 Left 1130674083 15:85937112-85937134 CCCCACATGCAGGGGGTGAACCC No data
Right 1130674091 15:85937155-85937177 TTTTGTCTTGGCTGCCTACCTGG No data
1130674085_1130674091 18 Left 1130674085 15:85937114-85937136 CCACATGCAGGGGGTGAACCCAC No data
Right 1130674091 15:85937155-85937177 TTTTGTCTTGGCTGCCTACCTGG No data
1130674084_1130674091 19 Left 1130674084 15:85937113-85937135 CCCACATGCAGGGGGTGAACCCA No data
Right 1130674091 15:85937155-85937177 TTTTGTCTTGGCTGCCTACCTGG No data
1130674086_1130674091 0 Left 1130674086 15:85937132-85937154 CCCACTTCATTGCCCTTCAGCTG No data
Right 1130674091 15:85937155-85937177 TTTTGTCTTGGCTGCCTACCTGG No data
1130674087_1130674091 -1 Left 1130674087 15:85937133-85937155 CCACTTCATTGCCCTTCAGCTGT No data
Right 1130674091 15:85937155-85937177 TTTTGTCTTGGCTGCCTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130674091 Original CRISPR TTTTGTCTTGGCTGCCTACC TGG Intergenic
No off target data available for this crispr