ID: 1130674749

View in Genome Browser
Species Human (GRCh38)
Location 15:85941799-85941821
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130674744_1130674749 17 Left 1130674744 15:85941759-85941781 CCAATCATAAGCATTAGTCAAAA No data
Right 1130674749 15:85941799-85941821 GCCAATCAGGCCATTCCTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130674749 Original CRISPR GCCAATCAGGCCATTCCTAG GGG Intergenic
No off target data available for this crispr